ahpD
- Type
- protein_coding
- Name
- ahpD
- Locus Name
-
Rv2429
- Product
-
Alkyl hydroperoxide reductase D protein AhpD (alkyl hydroperoxidase D)
- Functional Category
-
Virulence, detoxification, adaptation
- Location
- 2726806..2727339 (+ strand)
- Gene Length
- 533 bp
- Nucleotides
-
TGAGTATAGAAAAGCTCAAGGCCGCGCTCCCCGAGTACGCCAAAGACATCAAGCTGAACCTGAGCTCAATCACCCGCAGCAGCGTGCTCGACCAGGAACAACTATGGGGAACCCTGCTGGCCAGCGCCGCAGCGACACGAAATCCGCAGGTATTAGCTGACATTGGCGCTGAAGCGACCGACCATCTGTCGGCTGCAGCCCGCCACGCAGCCCTCGGAGCCGCGGCCATCATGGGCATGAATAACGTGTTCTACCGTGGCCGCGGCTTCCTTGAAGGCCGGTACGACGACCTGCGCCCCGGACTGCGGATGAACATCATCGCCAATCCGGGCATACCGAAAGCCAACTTCGAGCTCTGGTCCTTCGCAGTGTCCGCGATCAACGGGTGCTCGCATTGCCTCGTCGCCCACGAGCACACGCTGCGTACGGTAGGTGTGGACCGAGAGGCGATCTTTGAAGCGCTGAAAGCCGCAGCAATCGTTTCAGGCGTTGCACAAGCGCTGGCCACAATCGAGGCACTAAGCCCAAGCTAA
- Drug Resistance
- Mutations
- Function
- Antioxidant protein with alkyl hydroperoxidase activity. Required for the reduction of the AhpC active site cysteine residues and for the regeneration of the AhpC enzyme activity.; FUNCTION: Together with AhpC, DlaT and Lpd, constitutes an NADH-dependent peroxidase active against hydrogen and alkyl peroxides as well as serving as a peroxynitrite reductase, thus protecting the bacterium against reactive nitrogen intermediates and oxidative stress generated by the host immune system.
- Family
-
AhpD family
- GO
-
- peroxiredoxin activity GO:0051920 molecular_function
- alkyl hydroperoxide reductase activity GO:0008785 molecular_function
- hydroperoxide reductase activity GO:0032843 molecular_function
- disulfide oxidoreductase activity GO:0015036 molecular_function
- cytosol GO:0005829 cellular_component
- plasma membrane GO:0005886 cellular_component
- cell redox homeostasis GO:0045454 biological_process
- peroxidase activity GO:0004601 molecular_function
- response to oxidative stress GO:0006979 biological_process
- InterPro
1GU9
- Name
- Alkyl hydroperoxide reductase AhpD (EC 1.11.1.15) (Alkylhydroperoxidase AhpD)
- Family
- AhpD family
- Protein Sequence
-
MSIEKLKAALPEYAKDIKLNLSSITRSSVLDQEQLWGTLLASAAATRNPQVLADIGAEATDHLSAAARHAALGAAAIMGMNNVFYRGRGFLEGRYDDLRPGLRMNIIANPGIPKANFELWSFAVSAINGCSHCLVAHEHTLRTVGVDREAIFEALKAAAIVSGVAQALATIEALSPS
- Mass
- 18,781 Da
- Length
- 177 Aa
Summary
Rv2429 doesn't seem to be a targeted by any drug.
-
-
Cell redox homeostasis R-HSA-1222541
Homo sapiensR-HSA-1222541
-
- The mechanism of Mycobacterium tuberculosis alkylhydroperoxidase AhpD as defined by mutagenesis, crystallography, and kinetics.
- J Biol Chem. 2003 Aug 8;278(32):29502-8. doi: 10.1074/jbc.M303747200. Epub 2003 May 21.
- Metabolic enzymes of mycobacteria linked to antioxidant defense by a thioredoxin-like protein.
- Science. 2002 Feb 8;295(5557):1073-7. doi: 10.1126/science.1067798. Epub 2002 Jan 17.
- The crystal structure of Mycobacterium tuberculosis alkylhydroperoxidase AhpD, a potential target for antitubercular drug design.
- J Biol Chem. 2002 May 31;277(22):20033-40. doi: 10.1074/jbc.M200864200. Epub 2002 Mar 25.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Intermolecular interactions in the AhpC/AhpD antioxidant defense system of Mycobacterium tuberculosis.
- Arch Biochem Biophys. 2004 Jul 1;427(1):41-7. doi: 10.1016/j.abb.2004.04.017.
- The AhpC and AhpD antioxidant defense system of Mycobacterium tuberculosis.
- J Biol Chem. 2000 Jun 23;275(25):18801-9. doi: 10.1074/jbc.M001001200.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.