Rv2573
- Type
- protein_coding
- Name
- Rv2573
- Locus Name
-
Rv2573
- Product
-
Conserved hypothetical protein
- Functional Category
-
Conserved hypotheticals
- Location
- 2898043..2898783 (+ strand)
- Gene Length
- 740 bp
- Nucleotides
-
TGGTGCCCGGTCCGGTGCACACCAGTCCTCGGGAGGTTGCCGGCCCGGTCGATGTGCTGATCCTGGCGGTCAAGGCCACTCAGAACGACGCCGCACGTCCCTGGCTGACCCGCCTGTGCGACGAGCGCACCGTGGTGGCCGTGCTGCAAAACGGTGTCGAACAGGTCGAGCAGGTCCAGCCGCATTGTCCGTCCTCGGCCGTGGTTCCCGCGATCGTGTGGTGTTCGGCCGAGACCCAGCCGCAAGGGTGGGTGCGCTTGCGCGGTGAAGCCGCACTGGTCGTTCCCACCGGGCCCGCGGCCGAGCAGTTCGCCGGGCTGCTGCGCGGTGCCGGCGCCACGGTGGACTGCGACCCCGACTTCACCACGGCGGCCTGGCGCAAACTACTGGTCAACGCGCTGGCGGGATTTATGGTGCTGTCCGGACGGCGGTCGGCAATGTTCCGCCGCGACGACGTCGCGGCATTGTCGCGCCGCTATGTCGCCGAATGCCTGGCGGTGGCGCGCGCTGAGGGTGCCCGACTCGATGACGACGTCGTCGACGAAGTGGTCCGCCTCGTCCGGTCGGCCCCGCAGGACATGGGCACCTCGATGCTGGCCGACCGGGCAGCCCACCGGCCACTGGAATGGGATTTGCGCAATGGGGTGATCGTCCGCAAGGCCCGCGCCCACGGCCTGGCCACCCCGATCAGCGACGTGCTGGTGCCGCTGCTGGCGGCTGCCAGCGACGGTCCCGGATAG
- Drug Resistance
- Mutations
- Function
- Catalyzes the NADPH-dependent reduction of ketopantoate into pantoic acid. {ECO:0000250}.
- Family
-
Ketopantoate reductase family
- GO
-
- 2-dehydropantoate 2-reductase activity GO:0008677 molecular_function
- cytosol GO:0005829 cellular_component
- pantothenate biosynthetic process from valine GO:0033317 biological_process
- NADP binding GO:0050661 molecular_function
- InterPro
4OL9
- Name
- Putative 2-dehydropantoate 2-reductase (EC 1.1.1.169) (Ketopantoate reductase) (KPA reductase) (KPR)
- Family
- Ketopantoate reductase family
- Protein Sequence
-
MATGIALVGPGAVGTTVAALLHKAGYSPLLCGHTPRAGIELRRDGADPIVVPGPVHTSPREVAGPVDVLILAVKATQNDAARPWLTRLCDERTVVAVLQNGVEQVEQVQPHCPSSAVVPAIVWCSAETQPQGWVRLRGEAALVVPTGPAAEQFAGLLRGAGATVDCDPDFTTAAWRKLLVNALAGFMVLSGRRSAMFRRDDVAALSRRYVAECLAVARAEGARLDDDVVDEVVRLVRSAPQDMGTSMLADRAAHRPLEWDLRNGVIVRKARAHGLATPISDVLVPLLAAASDGPG
- Mass
- 31,033 Da
- Length
- 295 Aa
Summary
Rv2573 doesn't seem to be a targeted by any drug.
-
-
Pantothenate and CoA biosynthesis mtu00770
mtu00770PATHWAY_MAP mtu00770 Pantothenate and CoA biosynthesis
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.