snoP
- Type
- protein_coding
- Name
- snoP
- Locus Name
-
Rv2604c
- Product
-
Probable glutamine amidotransferase SnoP
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 2931693..2932289 (- strand)
- Gene Length
- 596 bp
- Nucleotides
-
GTGAGCGTTCCACGGGTCGGGGTGCTGGCGCTGCAGGGCGACACCCGGGAGCACCTGGCTGCGCTGCGCGAATGCGGGGCCGAGCCGATGACGGTGCGGCGCCGCGACGAACTTGACGCGGTGGACGCGCTGGTCATCCCGGGCGGGGAATCCACCACGATGAGCCACCTGCTGCTCGACCTCGACCTGCTGGGACCGCTGCGGGCCCGGCTCGCCGATGGGCTTCCGGCCTATGGTTCGTGCGCGGGCATGATTCTGTTGGCCAGCGAGATCCTGGACGCCGGTGCGGCAGGCCGCCAGGCGCTGCCCCTGCGTGCGATGAATATGACGGTGCGGCGCAATGCTTTTGGAAGTCAGGTTGACTCGTTTGAAGGCGATATCGAGTTCGCTGGTCTAGACGATCCGGTGCGCGCGGTGTTCATCCGGGCGCCATGGGTTGAGCGAGTCGGTGACGGTGTGCAGGTGCTGGCCCGCGCGGCGGGGCACATCGTCGCGGTGCGCCAGGGTGCGGTGCTTGCCACCGCGTTTCATCCGGAGATGACCGGCGATCGCCGCATTCATCAGTTGTTCGTCGACATCGTCACCTCCGCGGCGTG
- Drug Resistance
- Mutations
- Function
- Catalyzes the hydrolysis of glutamine to glutamate and ammonia as part of the biosynthesis of pyridoxal 5'-phosphate. The resulting ammonia molecule is channeled to the active site of PdxS. {ECO:0000255|HAMAP-Rule:MF_01615}.
- Family
-
Glutaminase PdxT/SNO family
- GO
-
- pyridoxal 5'-phosphate synthase (glutamine hydrolysing) activity GO:0036381 molecular_function
- pyridoxine metabolic process GO:0008614 biological_process
- cytosol GO:0005829 cellular_component
- pyridoxal phosphate biosynthetic process GO:0042823 biological_process
- vitamin B6 biosynthetic process GO:0042819 biological_process
- glutaminase complex GO:1903600 cellular_component
- amine-lyase activity GO:0016843 molecular_function
- glutamine catabolic process GO:0006543 biological_process
- glutaminase activity GO:0004359 molecular_function
- InterPro
Summary
- Name
- Pyridoxal 5'-phosphate synthase subunit PdxT (EC 4.3.3.6) (Pdx2) (Pyridoxal 5'-phosphate synthase glutaminase subunit) (EC 3.5.1.2)
- Family
- Glutaminase PdxT/SNO family
- Protein Sequence
-
MSVPRVGVLALQGDTREHLAALRECGAEPMTVRRRDELDAVDALVIPGGESTTMSHLLLDLDLLGPLRARLADGLPAYGSCAGMILLASEILDAGAAGRQALPLRAMNMTVRRNAFGSQVDSFEGDIEFAGLDDPVRAVFIRAPWVERVGDGVQVLARAAGHIVAVRQGAVLATAFHPEMTGDRRIHQLFVDIVTSAA
- Mass
- 21,072 Da
- Length
- 198 Aa
Rv2604c doesn't seem to be a targeted by any drug.
Rv2604c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.