TB31.7
- Type
- protein_coding
- Name
- TB31.7
- Locus Name
-
Rv2623
- Product
-
Universal stress protein family protein TB31.7
- Functional Category
-
Virulence, detoxification, adaptation
- Location
- 2949593..2950486 (+ strand)
- Gene Length
- 893 bp
- Nucleotides
-
TGTCATCGGGCAATTCATCTCTGGGAATTATCGTCGGGATCGACGATTCACCGGCCGCACAGGTTGCGGTGCGGTGGGCAGCTCGGGATGCGGAGTTGCGAAAAATCCCTCTGACGCTCGTGCACGCGGTGTCGCCGGAAGTAGCCACCTGGCTGGAGGTGCCACTGCCGCCGGGCGTGCTGCGATGGCAGCAGGATCACGGGCGCCACCTGATCGACGACGCACTCAAGGTGGTTGAACAGGCTTCGCTGCGCGCTGGTCCCCCCACGGTCCACAGTGAAATCGTTCCGGCGGCAGCCGTTCCCACATTGGTCGACATGTCCAAAGACGCAGTGCTGATGGTCGTGGGTTGTCTCGGAAGTGGGCGGTGGCCGGGCCGGCTGCTCGGTTCGGTCAGTTCCGGCCTGCTCCGCCACGCGCACTGTCCGGTCGTGATCATCCACGACGAAGATTCGGTGATGCCGCATCCCCAGCAAGCGCCGGTGCTAGTTGGCGTTGACGGCTCGTCGGCCTCCGAGCTGGCGACCGCAATCGCATTCGACGAAGCGTCGCGGCGAAACGTGGACCTGGTGGCGCTGCACGCATGGAGCGACGTCGATGTGTCGGAGTGGCCCGGAATCGATTGGCCGGCAACTCAGTCGATGGCCGAGCAGGTGCTGGCCGAGCGGTTGGCGGGTTGGCAGGAGCGGTATCCCAACGTAGCCATAACCCGCGTGGTGGTGCGCGATCAGCCGGCCCGCCAGCTCGTCCAACGCTCCGAGGAAGCCCAGCTGGTCGTGGTCGGCAGCCGGGGCCGCGGCGGCTACGCCGGAATGCTGGTGGGGTCGGTAGGCGAAACCGTTGCTCAGCTGGCGCGGACGCCGGTCATCGTGGCACGCGAGTCGCTGACTTAG
- Drug Resistance
- Mutations
- Function
- May play a role in the establishment of a persistent infection (latency) in the host, as strains without this gene are hypervirulent. Overexpression of the protein retards growth in culture; Glu-15 and Ala-117 mutant proteins which bind less ATP do not show this retardation, suggesting growth may be regulated through an ATP-dependent function.
- Family
-
Universal stress protein A family
- GO
-
- pathogenesis GO:0009405 biological_process
- regulation of growth GO:0040008 biological_process
- cell wall GO:0005618 cellular_component
- ATP binding GO:0005524 molecular_function
- cytosol GO:0005829 cellular_component
- plasma membrane GO:0005886 cellular_component
- response to hypoxia GO:0001666 biological_process
- dormancy entry of symbiont in host GO:0085014 biological_process
- InterPro
2JAX
- Name
- Universal stress protein Rv2623 (USP Rv2623)
- Family
- Universal stress protein A family
- Protein Sequence
-
MSSGNSSLGIIVGIDDSPAAQVAVRWAARDAELRKIPLTLVHAVSPEVATWLEVPLPPGVLRWQQDHGRHLIDDALKVVEQASLRAGPPTVHSEIVPAAAVPTLVDMSKDAVLMVVGCLGSGRWPGRLLGSVSSGLLRHAHCPVVIIHDEDSVMPHPQQAPVLVGVDGSSASELATAIAFDEASRRNVDLVALHAWSDVDVSEWPGIDWPATQSMAEQVLAERLAGWQERYPNVAITRVVVRDQPARQLVQRSEEAQLVVVGSRGRGGYAGMLVGSVGETVAQLARTPVIVARESLT
- Mass
- 31,652 Da
- Length
- 297 Aa
Summary
Rv2623 doesn't seem to be a targeted by any drug.
Rv2623 doesn't seem to be involved in any pathway.
- Mycobacterium tuberculosis universal stress protein Rv2623 regulates bacillary growth by ATP-Binding: requirement for establishing chronic persistent infection.
- PLoS Pathog. 2009 May;5(5):e1000460. doi: 10.1371/journal.ppat.1000460. Epub 2009 May 29.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Heme oxygenase-1-derived carbon monoxide induces the Mycobacterium tuberculosis dormancy regulon.
- J Biol Chem. 2008 Jun 27;283(26):18032-9. doi: 10.1074/jbc.M802274200. Epub 2008 Apr 9.
- Mycobacterium tuberculosis senses host-derived carbon monoxide during macrophage infection.
- Cell Host Microbe. 2008 May 15;3(5):323-30. doi: 10.1016/j.chom.2008.03.007.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Expression of Th1-mediated immunity in mouse lungs induces a Mycobacterium tuberculosis transcription pattern characteristic of nonreplicating persistence.
- Proc Natl Acad Sci U S A. 2003 Jan 7;100(1):241-6. doi: 10.1073/pnas.0136863100. Epub 2002 Dec 27.
- Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program.
- J Exp Med. 2003 Sep 1;198(5):705-13. doi: 10.1084/jem.20030205.
- Hypoxic response of Mycobacterium tuberculosis studied by metabolic labeling and proteome analysis of cellular and extracellular proteins.
- J Bacteriol. 2002 Jul;184(13):3485-91. doi: 10.1128/jb.184.13.3485-3491.2002.
- Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.
- Proc Natl Acad Sci U S A. 2001 Jun 19;98(13):7534-9. doi: 10.1073/pnas.121172498.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.