dfrA
- Type
- protein_coding
- Name
- dfrA
- Locus Name
-
Rv2763c
- Product
-
Dihydrofolate reductase DfrA (DHFR) (tetrahydrofolate dehydrogenase)
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 3073130..3073609 (- strand)
- Gene Length
- 479 bp
- Nucleotides
-
ATGGTGGGGCTGATCTGGGCTCAAGCGACATCGGGTGTCATCGGCCGCGGCGGCGACATCCCCTGGCGCTTGCCCGAGGACCAGGCGCATTTCCGGGAGATCACCATGGGGCACACGATCGTGATGGGCCGGCGCACATGGGATTCGCTGCCGGCTAAAGTCCGGCCGCTGCCCGGCCGGCGAAATGTCGTACTGAGCCGCCAAGCTGACTTTATGGCCAGCGGGGCTGAGGTTGTCGGTTCACTCGAGGAGGCGCTGACCAGCCCGGAGACGTGGGTGATCGGAGGCGGACAAGTCTATGCGCTGGCGCTGCCGTACGCGACCAGATGTGAGGTTACCGAGGTCGACATCGGCCTGCCGCGCGAAGCCGGTGACGCGCTGGCCCCCGTGCTGGACGAGACATGGCGGGGCGAGACGGGGGAGTGGCGCTTCAGCCGGTCCGGGTTGCGGTACCGGTTGTACAGCTACCACCGCTCATG
- Drug Resistance
- Mutations
- Function
- Key enzyme in folate metabolism. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis.
- Family
-
Dihydrofolate reductase family
- GO
-
- dihydrofolate metabolic process GO:0046452 biological_process
- tetrahydrofolate biosynthetic process GO:0046654 biological_process
- folic acid metabolic process GO:0046655 biological_process
- cytosol GO:0005829 cellular_component
- NADP binding GO:0050661 molecular_function
- NADP+ binding GO:0070401 molecular_function
- glycine biosynthetic process GO:0006545 biological_process
- dihydrofolate reductase activity GO:0004146 molecular_function
- one-carbon metabolic process GO:0006730 biological_process
- InterPro
1DF7
- Name
- Dihydrofolate reductase (EC 1.5.1.3)
- Family
- Dihydrofolate reductase family
- Protein Sequence
-
MTMVGLIWAQATSGVIGRGGDIPWRLPEDQAHFREITMGHTIVMGRRTWDSLPAKVRPLPGRRNVVLSRQADFMASGAEVVGSLEEALTSPETWVIGGGQVYALALPYATRCEVTEVDIGLPREAGDALAPVLDETWRGETGEWRFSRSGLRYRLYSYHRS
- Mass
- 17,872 Da
- Length
- 161 Aa
Summary
- Isoniazid DB00951
-
4-pyridinecarbohydrazide | INH | Isoniazid | Isonicotinic acid hydrazide | Isonicotinic hydrazide | Isonicotinohydrazide | Isonicotinoylhydrazide | Isonicotinsaeurehydrazid | Isonicotinylhydrazine | Pyridine-4-carboxylic acid hydrazide
-
-
Folate biosynthesis mtu00790
mtu00790PATHWAY_MAP mtu00790 Folate biosynthesis
-
- Mycobacterium tuberculosis dihydrofolate reductase is a target for isoniazid.
- Nat Struct Mol Biol. 2006 May;13(5):408-13. doi: 10.1038/nsmb1089. Epub 2006 Apr 30.
- Three-dimensional structure of M. tuberculosis dihydrofolate reductase reveals opportunities for the design of novel tuberculosis drugs.
- J Mol Biol. 2000 Jan 14;295(2):307-23. doi: 10.1006/jmbi.1999.3328.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.