rip
- Type
- protein_coding
- Name
- rip
- Locus Name
-
Rv2869c
- Product
-
Membrane bound metalloprotease
- Functional Category
-
Cell wall and cell processes
- Location
- 3180548..3181762 (- strand)
- Gene Length
- 1214 bp
- Nucleotides
-
ATGATGTTTGTTACCGGCATTGTGCTGTTCGCGCTCGCGATCCTGATTTCGGTGGCCCTGCACGAATGTGGTCACATGTGGGTCGCGCGCCGCACCGGGATGAAGGTACGTCGCTATTTCGTCGGCTTTGGCCCCACGTTGTGGTCGACCCGGCGCGGCGAGACCGAATACGGTGTCAAAGCCGTTCCGCTGGGCGGCTTCTGTGACATCGCCGGCATGACCCCGGTCGAGGAACTCGACCCCGACGAACGTGACCGTGCGATGTACAAGCAGGCCACCTGGAAGCGGGTCGCAGTGTTATTCGCCGGGCCCGGAATGAACCTCGCTATCTGCCTGGTGCTGATCTATGCCATCGCGCTGGTCTGGGGGCTGCCTAACCTGCATCCGCCAACCAGGGCCGTAATCGGCGAAACTGGCTGCGTTGCACAGGAAGTGAGCCAGGGCAAGCTCGAGCAGTGCACCGGGCCCGGTCCGGCGGCGCTGGCCGGAATTCGCTCCGGTGACGTCGTGGTCAAGGTCGGTGACACCCCGGTGTCCAGTTTCGACGAGATGGCCGCCGCGGTGCGCAAGTCACACGGCAGCGTCCCGATCGTTGTCGAGCGTGACGGCACCGCGATTGTTACCTACGTGGACATCGAATCCACCCAACGCTGGATCCCTAACGGGCAGGGCGGTGAGCTCCAGCCGGCAACGGTCGGTGCGATTGGGGTGGGCGCCGCCCGGGTCGGGCCTGTGCGCTACGGCGTGTTCTCCGCCATGCCGGCCACATTCGCGGTCACCGGCGACCTGACCGTGGAGGTGGGCAAGGCGCTGGCCGCCCTCCCGACCAAGGTAGGTGCGCTGGTGCGGGCGATCGGCGGCGGGCAGCGTGACCCGCAGACGCCGATAAGTGTGGTGGGCGCCAGCATCATCGGCGGCGACACCGTCGACCATGGGCTGTGGGTGGCGTTCTGGTTCTTCTTGGCCCAGCTGAACCTCATCCTGGCTGCGATCAACCTGCTGCCGTTGCTGCCGTTCGATGGCGGCCATATTGCCGTCGCGGTGTTCGAGAGGATCCGCAACATGGTCCGGTCGGCTCGTGGCAAGGTGGCGGCCGCACCGGTGAATTACCTCAAACTCTTGCCGGCGACCTATGTGGTCTTGGTTCTTGTCGTCGGGTACATGCTCTTGACCGTCACCGCCGACCTGGTCAACCCGATTAGGCTTTTCCAGTA
- Drug Resistance
- Mutations
- Function
- A probable intramembrane site-2 protease (S2P) that cleaves type-2 transmembrane proteins within their membrane-spanning domains. Cleaves PbpB (PBP3, FtsI) near 'Ala-102' and 'Ala-103' in response to oxidative stress; cleavage is inhibited by Wag31-PbpB interaction. Probably also cleaves anti-sigma factors RskA, RslA and RsmA but not RsdA. {ECO:0000269|PubMed:19496931}.; FUNCTION: Regulated intramembrane proteolysis (RIP) occurs when an extracytoplasmic signal (possibly oxidative stress) triggers a concerted proteolytic cascade to transmit information and elicit cellular responses. The membrane-spanning regulatory substrate protein (includes anti-sigma factors RskA, RslA, RsmA, and PbpB in M.tuberculosis) is first cut extracytoplasmically (site-1 protease, S1P), then within the membrane itself (site-2 protease, S2P, this entry), while cytoplasmic proteases finish degrading the regulatory protein, liberating the effector protein (ECF sigma factors SigK, SigL and SigM). {ECO:0000269|PubMed:19496931}.
- Family
-
Peptidase M50B family
- GO
-
- metal ion binding GO:0046872 molecular_function
- plasma membrane GO:0005886 cellular_component
- metalloendopeptidase activity GO:0004222 molecular_function
- integral component of membrane GO:0016021 cellular_component
- InterPro
Summary
- Name
- Zinc metalloprotease Rip1 (EC 3.4.24.-) (Regulator of sigma KLM proteases) (S2P endopeptidase) (Site-2 protease Rip1) (S2P protease Rip1) (Site-2-type intramembrane protease)
- Family
- Peptidase M50B family
- Protein Sequence
-
MMFVTGIVLFALAILISVALHECGHMWVARRTGMKVRRYFVGFGPTLWSTRRGETEYGVKAVPLGGFCDIAGMTPVEELDPDERDRAMYKQATWKRVAVLFAGPGMNLAICLVLIYAIALVWGLPNLHPPTRAVIGETGCVAQEVSQGKLEQCTGPGPAALAGIRSGDVVVKVGDTPVSSFDEMAAAVRKSHGSVPIVVERDGTAIVTYVDIESTQRWIPNGQGGELQPATVGAIGVGAARVGPVRYGVFSAMPATFAVTGDLTVEVGKALAALPTKVGALVRAIGGGQRDPQTPISVVGASIIGGDTVDHGLWVAFWFFLAQLNLILAAINLLPLLPFDGGHIAVAVFERIRNMVRSARGKVAAAPVNYLKLLPATYVVLVLVVGYMLLTVTADLVNPIRLFQ
- Mass
- 42,834 Da
- Length
- 404 Aa
Rv2869c doesn't seem to be a targeted by any drug.
Rv2869c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Novel role of Wag31 in protection of mycobacteria under oxidative stress.
- Mol Microbiol. 2009 Jul;73(1):103-19. doi: 10.1111/j.1365-2958.2009.06750.x. Epub 2009 Jun 1.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.