fpg
- Type
- protein_coding
- Name
- fpg
- Locus Name
-
Rv2924c
- Product
-
Probable formamidopyrimidine-DNA glycosylase Fpg (FAPY-DNA glycosylase)
- Functional Category
-
Information pathways
- Location
- 3238601..3239470 (- strand)
- Gene Length
- 869 bp
- Nucleotides
-
ATGCCCGAGCTGCCCGAAGTCGAGGTGGTGCGGCGCGGCTTGCAGGCTCACGTGACCGGCCGGACCATCACCGAGGTTCGGGTGCACCACCCCCGCGCTGTGCGCCGCCACGATGCCGGGCCCGCGGATCTGACGGCGCGGCTGCGGGGAGCGCGGATCAACGGAACCGATCGGCGCGGCAAGTACCTGTGGTTGACACTCAATACGGCTGGGGTCCATAGGCCGACGGACACCGCACTCGTGGTGCACCTGGGCATGAGTGGGCAGATGCTGCTCGGGGCGGTGCCGTGTGCCGCTCACGTCCGGATTTCCGCGCTGCTCGACGACGGGACCGTGCTGAGCTTCGCTGACCAACGGACCTTCGGAGGGTGGCTGCTTGCCGACCTGGTGACGGTGGACGGCAGCGTGGTACCGGTGCCGGTCGCCCACCTGGCGCGCGACCCGCTTGACCCGCGGTTCGATTGTGACGCTGTAGTTAAAGTGTTGCGGCGCAAGCATTCCGAACTCAAGCGCCAGCTGCTGGATCAGCGGGTGGTGTCGGGAATCGGCAACATCTATGCCGATGAGGCGCTGTGGCGGGCCAAGGTGAACGGCGCCCACGTCGCCGCCACACTAAGGTGCCGGCGTCTGGGAGCGGTCCTGCATGCCGCCGCCGACGTGATGCGCGAAGCGCTGGCGAAAGGTGGCACCTCGTTCGACTCTTTGTATGTCAACGTCAACGGCGAGTCGGGCTACTTCGAGCGGTCGCTGGACGCTTATGGCCGCGAAGGCGAAAACTGTCGGCGCTGCGGCGCGGTGATACGCCGGGAGAGGTTTATGAACCGCTCGTCGTTCTACTGCCCGCGATGCCAGCCGCGGCCCCGAAAGTA
- Drug Resistance
- Mutations
- Function
- Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases. Has a preference for oxidized purines, such as 7,8-dihydro-8-oxoguanine (8-oxoG) when paired with C, G or T, as well as methyl-faPy (formanidopyrimidine residues) in poly(dG-dC) and spiroiminodihydantoin:C base pairs. Unlike its E.coli ortholog has no activity on 8-oxoG:A. Has AP (apurinic/apyrimidinic) lyase activity and introduces nicks in the DNA strand. Cleaves the DNA backbone by beta-delta elimination to generate a single-strand break at the site of the removed base with both 3'- and 5'-phosphates. Cleaves ssDNA containing an AP site. Complements the H(2)O(2) sensitivity of an M.smegmatis fpg disruption mutant; upon expression in M.smegmatis excises 8-oxoG from dsDNA. {ECO:0000269|PubMed:17698424, ECO:0000269|PubMed:19496823, ECO:0000269|PubMed:20031487}.
- Family
-
FPG family
- GO
-
- class I DNA-(apurinic or apyrimidinic site) endonuclease activity GO:0140078 molecular_function
- DNA N-glycosylase activity GO:0019104 molecular_function
- 8-oxo-7,8-dihydroguanine DNA N-glycosylase activity GO:0034039 molecular_function
- DNA-(apurinic or apyrimidinic site) endonuclease activity GO:0003906 molecular_function
- damaged DNA binding GO:0003684 molecular_function
- double-stranded DNA binding GO:0003690 molecular_function
- nucleotide-excision repair GO:0006289 biological_process
- base-excision repair, AP site formation GO:0006285 biological_process
- base-excision repair GO:0006284 biological_process
- DNA repair GO:0006281 biological_process
- plasma membrane GO:0005886 cellular_component
- response to oxidative stress GO:0006979 biological_process
- zinc ion binding GO:0008270 molecular_function
- oxidized purine nucleobase lesion DNA N-glycosylase activity GO:0008534 molecular_function
- InterPro
Summary
- Name
- Formamidopyrimidine-DNA glycosylase 1 (Fapy-DNA glycosylase 1) (EC 3.2.2.23) (DNA-(apurinic or apyrimidinic site) lyase MutM 1) (AP lyase MutM 1) (EC 4.2.99.18)
- Family
- FPG family
- Protein Sequence
-
MPELPEVEVVRRGLQAHVTGRTITEVRVHHPRAVRRHDAGPADLTARLRGARINGTDRRGKYLWLTLNTAGVHRPTDTALVVHLGMSGQMLLGAVPCAAHVRISALLDDGTVLSFADQRTFGGWLLADLVTVDGSVVPVPVAHLARDPLDPRFDCDAVVKVLRRKHSELKRQLLDQRVVSGIGNIYADEALWRAKVNGAHVAATLRCRRLGAVLHAAADVMREALAKGGTSFDSLYVNVNGESGYFERSLDAYGREGENCRRCGAVIRRERFMNRSSFYCPRCQPRPRK
- Mass
- 31,951 Da
- Length
- 289 Aa
Rv2924c doesn't seem to be a targeted by any drug.
-
-
Base excision repair mtu03410
mtu03410Genetic Information Processing; Replication and repair
-
- Base excision and nucleotide excision repair pathways in mycobacteria.
- Tuberculosis (Edinb). 2011 Nov;91(6):533-43. doi: 10.1016/j.tube.2011.06.005. Epub 2011 Jul 18.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts.
- DNA Repair (Amst). 2010 Feb 4;9(2):177-90. doi: 10.1016/j.dnarep.2009.11.008. Epub 2009 Dec 23.
- Characterization of the major formamidopyrimidine-DNA glycosylase homolog in Mycobacterium tuberculosis and its linkage to variable tandem repeats.
- FEMS Immunol Med Microbiol. 2009 Jul;56(2):151-61. doi: 10.1111/j.1574-695X.2009.00562.x. Epub 2009 Jun 3.
- A distinct role of formamidopyrimidine DNA glycosylase (MutM) in down-regulation of accumulation of G, C mutations and protection against oxidative stress in mycobacteria.
- DNA Repair (Amst). 2007 Dec 1;6(12):1774-85. doi: 10.1016/j.dnarep.2007.06.009. Epub 2007 Aug 16.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.