Rv2969c
- Type
- protein_coding
- Name
- Rv2969c
- Locus Name
-
Rv2969c
- Product
-
Possible conserved membrane or secreted protein
- Functional Category
-
Cell wall and cell processes
- Location
- 3323709..3324476 (- strand)
- Gene Length
- 767 bp
- Nucleotides
-
GTGGCCGACAAATCCAAACGCCCCCCGCGATTCGATCTGAAGTCCGCCGACGGCAGCTTCGGCCGGCTCGTCCAGATTGGTGGCACCACCATCGTCGTCGTTTTTGCCGTCGTCCTGGTCTTCTACATCGTGACGTCGCGCGACGACAAGAAGGACGGCGTCGCGGGCCCCGGCGATGCAGTACGGGTGACGTCGAGCAAGCTGGTCACCCAGCCCGGAACCAGCAACCCCAAGGCCGTGGTGTCCTTCTACGAGGATTTCCTGTGTCCGGCGTGCGGCATATTCGAGCGCGGTTTCGGGCCAACCGTGTCCAAGCTCGTGGACATCGGCGCTGTCGCGGCCGATTACACGATGGTGGCCATTCTCGATAGCGCCAGCAATCAACACTATTCGTCGCGAGCGGCTGCTGCGGCTTATTGCGTTGCCGACGAATCGATCGAGGCGTTCCGCCGCTTCCACGCCGCCTTGTTCAGCAAGGACATCCAGCCTGCCGAGCTCGGCAAGGATTTCCCCGACAACGCGCGGTTGATCGAACTTGCCCGCGAAGCCGGCGTCGTGGGCAAGGTGCCCGACTGCATCAACAGCGGCAAGTACATCGAAAAAGTCGACGGGCTGGCGGCGGCGGTCAACGTGCACGCGACCCCGACGGTCCGGGTCAATGGCACAGAGTACGAGTGGTCGACGCCGGCGGCGCTGGTCGCCAAGATCAAAGAAATTGTGGGTGATGTGCCGGGCATTGACTCGGCCGCTGCTACCGCGACATCCTG
- Drug Resistance
- Mutations
- Function
- Unknown
- Family
-
Unknown
- GO
-
- cell surface GO:0009986 cellular_component
- cell wall GO:0005618 cellular_component
- plasma membrane GO:0005886 cellular_component
- InterPro
4IHU
- Name
- Possible conserved membrane or secreted protein
- Family
- Unknown
- Protein Sequence
-
MADKSKRPPRFDLKSADGSFGRLVQIGGTTIVVVFAVVLVFYIVTSRDDKKDGVAGPGDAVRVTSSKLVTQPGTSNPKAVVSFYEDFLCPACGIFERGFGPTVSKLVDIGAVAADYTMVAILDSASNQHYSSRAAAAAYCVADESIEAFRRFHAALFSKDIQPAELGKDFPDNARLIELAREAGVVGKVPDCINSGKYIEKVDGLAAAVNVHATPTVRVNGTEYEWSTPAALVAKIKEIVGDVPGIDSAAATATS
- Mass
- 26,862 Da
- Length
- 255 Aa
Summary
Rv2969c doesn't seem to be a targeted by any drug.
Rv2969c doesn't seem to be involved in any pathway.
- Structure analysis of the extracellular domain reveals disulfide bond forming-protein properties of Mycobacterium tuberculosis Rv2969c.
- Protein Cell. 2013 Aug;4(8):628-40. doi: 10.1007/s13238-013-3033-x. Epub 2013 Jul 5.
- Structural and biochemical characterization of the essential DsbA-like disulfide bond forming protein from Mycobacterium tuberculosis.
- BMC Struct Biol. 2013 Oct 18;13:23. doi: 10.1186/1472-6807-13-23.
- Rv2969c, essential for optimal growth in Mycobacterium tuberculosis, is a DsbA-like enzyme that interacts with VKOR-derived peptides and has atypical features of DsbA-like disulfide oxidases.
- Acta Crystallogr D Biol Crystallogr. 2013 Oct;69(Pt 10):1981-94. doi: 10.1107/S0907444913017800. Epub 2013 Sep 20.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.