nrdF2
- Type
- protein_coding
- Name
- nrdF2
- Locus Name
-
Rv3048c
- Product
-
Ribonucleoside-diphosphate reductase (beta chain) NrdF2 (ribonucleotide reductase small subunit) (R2F protein)
- Functional Category
-
Information pathways
- Location
- 3408404..3409378 (- strand)
- Gene Length
- 974 bp
- Nucleotides
-
GTGACTGGAAACGCAAAGCTAATTGATCGAGTCTCAGCGATCAACTGGAACCGACTGCAAGATGAGAAGGACGCCGAGGTCTGGGATCGGCTGACCGGAAACTTCTGGCTGCCCGAGAAGGTGCCGGTGTCCAATGACATCCCGTCGTGGGGCACCCTGACCGCCGGCGAGAAGCAACTAACCATGCGGGTCTTCACCGGCCTGACCATGCTGGACACCATCCAGGGCACCGTTGGTGCGGTCAGCCTGATTCCCGACGCGCTGACTCCGCATGAGGAGGCGGTGTTGACCAACATCGCGTTTATGGAGTCGGTGCACGCCAAGAGCTACAGCCAGATCTTCTCCACGCTGTGTTCCACCGCCGAGATCGACGACGCCTTCCGCTGGTCGGAGGAAAATCGCAATCTGCAGCGCAAGGCCGAGATCGTGCTGCAGTACTACCGCGGCGACGAGCCGCTCAAGCGCAAGGTGGCCTCCACCCTGCTGGAGAGCTTCCTGTTCTACTCTGGGTTCTACCTGCCGATGTACTGGTCGAGTCGGGCCAAGTTGACCAACACCGCCGACATGATCCGGCTGATCATCCGCGACGAGGCCGTGCACGGTTACTACATCGGCTATAAGTTCCAGCGTGGTCTGGCGTTGGTTGACGACGTCACGCGCGCCGAGCTCAAGGACTACACCTACGAGCTACTGTTCGAGCTCTACGACAACGAGGTGGAATACACCCAGGACCTCTACGACGAGGTCGGGCTAACCGAGGACGTCAAGAAGTTCTTGCGCTACAACGCCAACAAGGCGCTGATGAACCTCGGCTATGAGGCGCTGTTCCCCCGCGATGAGACCGACGTGAACCCGGCCATCCTGTCGGCGCTGTCACCCAACGCCGACGAGAACCATGACTTCTTCTCCGGATCCGGGTCGAGCTATGTGATCGGCAAGGCGGTCGTCACCGAGGACGATGACTGGGACTTCTA
- Drug Resistance
- Mutations
- Function
- Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides. Two genes for this protein are present in M.tuberculosis; this is the active form. When coexpressed in E.coli with nrdE the 2 proteins complement a temperature-sensitive E.coli mutant. {ECO:0000269|PubMed:9335290}.
- Family
-
Ribonucleoside diphosphate reductase small chain family
- GO
-
- metal ion binding GO:0046872 molecular_function
- deoxyribonucleotide biosynthetic process GO:0009263 biological_process
- ribonucleoside-diphosphate reductase complex GO:0005971 cellular_component
- DNA replication GO:0006260 biological_process
- ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor GO:0004748 molecular_function
- InterPro
1UZR
- Name
- Ribonucleoside-diphosphate reductase subunit beta nrdF2 (EC 1.17.4.1) (Ribonucleoside-diphosphate reductase nrdF2) (Ribonucleotide reductase R2-2 small subunit)
- Family
- Ribonucleoside diphosphate reductase small chain family
- Protein Sequence
-
MTGNAKLIDRVSAINWNRLQDEKDAEVWDRLTGNFWLPEKVPVSNDIPSWGTLTAGEKQLTMRVFTGLTMLDTIQGTVGAVSLIPDALTPHEEAVLTNIAFMESVHAKSYSQIFSTLCSTAEIDDAFRWSEENRNLQRKAEIVLQYYRGDEPLKRKVASTLLESFLFYSGFYLPMYWSSRAKLTNTADMIRLIIRDEAVHGYYIGYKFQRGLALVDDVTRAELKDYTYELLFELYDNEVEYTQDLYDEVGLTEDVKKFLRYNANKALMNLGYEALFPRDETDVNPAILSALSPNADENHDFFSGSGSSYVIGKAVVTEDDDWDF
- Mass
- 36,992 Da
- Length
- 324 Aa
Summary
Rv3048c doesn't seem to be a targeted by any drug.
-
-
Purine metabolism mtu00230
mtu00230PATHWAY_MAP mtu00230 Purine metabolism
-
- Crystal structure of the biologically active form of class Ib ribonucleotide reductase small subunit from Mycobacterium tuberculosis.
- FEBS Lett. 2004 Jul 2;569(1-3):117-22. doi: 10.1016/j.febslet.2004.05.059.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Ribonucleotide reduction in Mycobacterium tuberculosis: function and expression of genes encoding class Ib and class II ribonucleotide reductases.
- Infect Immun. 2003 Nov;71(11):6124-31. doi: 10.1128/iai.71.11.6124-6131.2003.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
- Characterization of two genes encoding the Mycobacterium tuberculosis ribonucleotide reductase small subunit.
- J Bacteriol. 1997 Oct;179(20):6408-15. doi: 10.1128/jb.179.20.6408-6415.1997.