moaR1
- Type
- protein_coding
- Name
- moaR1
- Locus Name
-
Rv3124
- Product
-
Transcriptional regulatory protein MoaR1
- Functional Category
-
Regulatory proteins
- Location
- 3489506..3490375 (+ strand)
- Gene Length
- 869 bp
- Nucleotides
-
TGCAATTCAACGTCTTAGGACCACTGGAACTAAACCTCCGGGGCACCAAACTGCCATTGGGAACGCCGAAACAACGTGCCGTGCTCGCCATGCTGTTGCTATCCCGGAACCAAGTCGTAGCGGCCGACGCACTGGTCCAGGCAATCTGGGAGAAGTCGCCACCTGCACGAGCCCGACGCACCGTCCACACGTACATTTGCAACCTTCGCCGGACCCTGAGCGATGCAGGCGTTGATTCGCGCAACATCTTGGTTAGTGAGCCGCCGGGCTATCGCCTTCTCATTGGAGATCGACAGCAATGCGATCTCGACCGTTTCGTGGCAGCGAAAGAATCGGGACTGCGCGCTTCTGCCAAAGGATATTTTAGCGAGGCGATCCGTTATCTAGATTCGGCCTTGCAGAATTGGCGCGGTCCAGTACTGGGGGACCTACGCAGCTTTATGTTTGTCCAAATGTTCAGCAGGGCGTTGACCGAAGATGAGCTCCTCGTCCATACGAAGCTGGCCGAAGCTGCAATCGCCTGCGGACGCGCCGACGTCGTTATCCCTAAATTGGAAAGACTCGTTGCGATGCATCCTTATCGCGAGTCGTTATGGAAGCAGTTAATGCTCGGCTACTACGTGAACGAATACCAGTCCGCGGCAATCGACGCATATCATAGACTCAAGTCCACGCTCGCAGAGGAACTCGGTGTTGAGCCGGCACCCACGATACGTGCGCTCTACCACAAAATTCTTCGCCAATTGCCCATGGACGATCTCGTCGGCCGAGTCACGCGTGGCAGGGTTGACTTGCGTGGCGGCAACGGCGCTAAGGTAGAGGAACTGACCGAGAGCGATAAGGATCTCCTTCCCATCGGTTTGGCATAA
- Drug Resistance
- Mutations
- Function
- Acts as a positive transcriptional regulator of the molybdopterin biosynthesis moa1 locus, promoting the expression of the moaA1B1C1D1 genes. Binds directly to the moaA1 promoter. {ECO:0000269|PubMed:20378651}.
- Family
-
AfsR/DnrI/RedD regulatory family
- GO
-
- molybdopterin cofactor biosynthetic process GO:0032324 biological_process
- DNA binding GO:0003677 molecular_function
- regulation of transcription, DNA-templated GO:0006355 biological_process
- phosphorelay signal transduction system GO:0000160 biological_process
- InterPro
Summary
- Name
- Transcriptional regulatory protein MoaR1 (Molybdopterin biosynthesis positive regulator)
- Family
- AfsR/DnrI/RedD regulatory family
- Protein Sequence
-
MGQRPFSPNHRSGVLNATTAGAVQFNVLGPLELNLRGTKLPLGTPKQRAVLAMLLLSRNQVVAADALVQAIWEKSPPARARRTVHTYICNLRRTLSDAGVDSRNILVSEPPGYRLLIGDRQQCDLDRFVAAKESGLRASAKGYFSEAIRYLDSALQNWRGPVLGDLRSFMFVQMFSRALTEDELLVHTKLAEAAIACGRADVVIPKLERLVAMHPYRESLWKQLMLGYYVNEYQSAAIDAYHRLKSTLAEELGVEPAPTIRALYHKILRQLPMDDLVGRVTRGRVDLRGGNGAKVEELTESDKDLLPIGLA
- Mass
- 34,525 Da
- Length
- 311 Aa
Rv3124 doesn't seem to be a targeted by any drug.
Rv3124 doesn't seem to be involved in any pathway.
- Characterization of the transcriptional regulator Rv3124 of Mycobacterium tuberculosis identifies it as a positive regulator of molybdopterin biosynthesis and defines the functional consequences of a non-synonymous SNP in the Mycobacterium bovis BCG orthologue.
- Microbiology. 2010 Jul;156(Pt 7):2112-23. doi: 10.1099/mic.0.037200-0. Epub 2010 Apr 8.
- Gene expression profile of Mycobacterium tuberculosis in a non-replicating state.
- Tuberculosis (Edinb). 2004;84(3-4):239-46. doi: 10.1016/j.tube.2003.12.006.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.