devS



Type
protein_coding
Name
devS
Locus Name

Rv3132c

Product

Two component sensor histidine kinase DevS

Functional Category

Regulatory proteins

Location
3497529..3499265 (- strand)
Gene Length
1736 bp
Nucleotides
ATGACAACAGGGGGCCTCGTCGACGAAAACGACGGCGCCGCAATGCGTCCACTGCGTCACACGCTCTCCCAACTACGCCTGCACGAGCTGCTGGTCGAGGTGCAGGACCGGGTCGAGCAGATCGTCGAGGGCCGGGACCGCCTCGATGGTCTGGTGGAGGCCATGCTCGTGGTCACAGCGGGCCTGGACCTGGAGGCAACCCTACGCGCTATCGTGCATTCAGCGACCAGCCTTGTCGATGCGCGCTATGGCGCTATGGAGGTGCACGACCGGCAGCATCGGGTATTGCACTTTGTCTATGAAGGCATCGACGAGGAGACCGTTCGGCGGATCGGCCACCTACCGAAAGGCCTAGGCGTCATCGGGCTGCTCATCGAAGATCCCAAACCGTTACGGCTGGACGATGTTTCTGCGCACCCGGCCTCGATTGGTTTTCCGCCGTATCATCCGCCGATGCGTACCTTCCTCGGGGTACCGGTTCGGGTGCGCGATGAATCGTTCGGCACTCTGTACCTGACTGACAAGACCAACGGGCAACCGTTCAGCGACGACGACGAGGTTCTGGTCCAGGCGCTGGCGGCCGCCGCGGGTATCGCAGTCGCGAATGCCCGGCTCTACCAGCAGGCTAAGGCGCGTCAGTCGTGGATCGAGGCCACCCGTGACATCGCCACCGAGTTGTTGTCCGGCACCGAACCCGCGACGGTGTTCCGGCTTGTCGCCGCGGAGGCGCTCAAGCTGACGGCGGCTGACGCTGCCCTGGTAGCCGTTCCCGTCGACGAGGACATGCCTGCCGCTGACGTGGGGGAGCTGCTGGTGATTGAAACAGTCGGCAGCGCTGTGGCTTCCATTGTTGGGCGAACGATTCCGGTGGCGGGCGCGGTGCTGCGGGAGGTCTTCGTCAACGGCATTCCGCGACGGGTCGACCGGGTCGATTTGGAAGGCCTGGACGAACTGGCCGACGCAGGTCCGGCGCTGCTGTTGCCGCTGCGGGCCAGAGGTACCGTAGCGGGTGTCGTTGTTGTGCTGAGTCAAGGCGGTCCAGGGGCTTTCACCGACGAACAACTCGAGATGATGGCCGCGTTCGCCGACCAGGCCGCGCTGGCTTGGCAATTGGCCACTTCGCAACGTCGGATGCGCGAACTCGACGTACTGACCGACCGGGATCGTATCGCCCGTGACCTCCATGACCATGTCATCCAGCGGCTCTTCGCGATTGGCCTGGCTTTGCAGGGTGCTGTCCCGCACGAACGTAATCCTGAAGTGCAGCAACGACTCTCGGACGTGGTAGACGATCTGCAAGACGTTATACAGGAAATCCGGACCACCATTTATGACCTGCACGGAGCATCGCAGGGTATCACTCGGCTCCGGCAGCGAATCGATGCGGCCGTAGCCCAATTTGCCGACTCGGGGTTGCGCACCAGCGTTCAATTCGTGGGTCCATTGTCGGTGGTCGACAGCGCGCTCGCCGATCAGGCCGAGGCGGTGGTTCGGGAAGCGGTCAGCAACGCGGTTCGCCATGCGAAGGCCAGCACGTTGACCGTCCGGGTCAAAGTCGACGACGACTTGTGCATCGAGGTGACCGACAACGGCCGCGGGCTGCCCGACGAGTTCACCGGAAGCGGCTTAACGAACCTGCGGCAGCGGGCAGAGCAGGCCGGCGGCGAATTCACCCTCGCGAGCGTACCGGGCGCGAGCGGAACAGTGCTGCGATGGTCAGCACCGTTGTCGCAGTA
Drug Resistance

Check for drug resistance association at TBDREAMDB

Mutations

Check for mutants available at TARGET


Function
Member of the two-component regulatory system DevR/DevS (DosR/DosS) involved in onset of the dormancy response (PubMed:12953092). Regulates an approximately 48-member regulon (PubMed:12953092, PubMed:11416222, PubMed:15033981, PubMed:18400743). Required for full induction of the DevR (DosR) regulon; acts later than DosT to positively regulate expression of the DevR regulon during adaptation to anaerobiosis (PubMed:19487478). Characterized as an oxygen sensor; O(2) acts as a switch, with O(2)-bound Fe(2+) protein inactive in autophosphorylation (PubMed:17371046, PubMed:17600145, PubMed:18975917, PubMed:19463006, PubMed:28977726). Has also been suggested to act as a redox sensor, or perhaps as a dual oxygen/redox sensor (PubMed:17609369). Autophosphorylates under anaerobic but not aerobic conditions, binding of NO or CO does not dramatically change the level of autophosphorylation of Fe(2+) protein, binding of O(2) inactivates kinase activity (PubMed:17600145, PubMed:18975917, PubMed:27235395). Binds O(2), NO, CO (PubMed:17371046, PubMed:17609369, PubMed:17600145, PubMed:18975917, PubMed:27235395). It is probably reduced by flavin nucleotides such as FMN and FAD (PubMed:19276084). May be the primary sensor for CO (PubMed:18400743). Donates a phosphate group to transcriptional regulator DevR (DosR) (PubMed:15033981, PubMed:15073296, PubMed:28977726). {ECO:0000269|PubMed:11416222, ECO:0000269|PubMed:12953092, ECO:0000269|PubMed:15033981, ECO:0000269|PubMed:15073296, ECO:0000269|PubMed:17371046, ECO:0000269|PubMed:17600145, ECO:0000269|PubMed:17609369, ECO:0000269|PubMed:18400743, ECO:0000269|PubMed:18474359, ECO:0000269|PubMed:18975917, ECO:0000269|PubMed:19463006, ECO:0000269|PubMed:19487478, ECO:0000269|PubMed:27235395, ECO:0000269|PubMed:28977726}.
Family

Unknown

GO
InterPro

UniProt
P9WGK3
GenBank
Rv3132c
EnsemblBacteria
Rv3132c
Mycobrowser
Rv3132c


2W3D
Summary
Name
Oxygen sensor histidine kinase response regulator DevS/DosS (EC 2.7.13.3)
Family
Unknown
Protein Sequence
MTTGGLVDENDGAAMRPLRHTLSQLRLHELLVEVQDRVEQIVEGRDRLDGLVEAMLVVTAGLDLEATLRAIVHSATSLVDARYGAMEVHDRQHRVLHFVYEGIDEETVRRIGHLPKGLGVIGLLIEDPKPLRLDDVSAHPASIGFPPYHPPMRTFLGVPVRVRDESFGTLYLTDKTNGQPFSDDDEVLVQALAAAAGIAVANARLYQQAKARQSWIEATRDIATELLSGTEPATVFRLVAAEALKLTAADAALVAVPVDEDMPAADVGELLVIETVGSAVASIVGRTIPVAGAVLREVFVNGIPRRVDRVDLEGLDELADAGPALLLPLRARGTVAGVVVVLSQGGPGAFTDEQLEMMAAFADQAALAWQLATSQRRMRELDVLTDRDRIARDLHDHVIQRLFAIGLALQGAVPHERNPEVQQRLSDVVDDLQDVIQEIRTTIYDLHGASQGITRLRQRIDAAVAQFADSGLRTSVQFVGPLSVVDSALADQAEAVVREAVSNAVRHAKASTLTVRVKVDDDLCIEVTDNGRGLPDEFTGSGLTNLRQRAEQAGGEFTLASVPGASGTVLRWSAPLSQ
Mass
62,241 Da
Length
578 Aa

Rv3132c doesn't seem to be a targeted by any drug.



Crystal structures of the CO and NOBound DosS GAF-A domain and implications for DosS signaling in Mycobacterium tuberculosis.
Arch Biochem Biophys. 2016 Dec 15;612:1-8. doi: 10.1016/j.abb.2016.10.005. Epub 2016 Oct 8.
Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.
J Biol Chem. 2013 May 3;288(18):12437-47. doi: 10.1074/jbc.M112.442467. Epub 2013 Mar 13.
Blockage of the channel to heme by the E87 side chain in the GAF domain of Mycobacterium tuberculosis DosS confers the unique sensitivity of DosS to oxygen.
FEBS Lett. 2011 Jun 23;585(12):1873-8. doi: 10.1016/j.febslet.2011.04.050. Epub 2011 Apr 27.
Structural insight into the heme-based redox sensing by DosS from Mycobacterium tuberculosis.
J Biol Chem. 2009 May 8;284(19):13057-67. doi: 10.1074/jbc.M808905200. Epub 2009 Mar 10.
The DosS-DosT/DosR Mycobacterial Sensor System.
Biosensors (Basel). 2013;3(3):259-282. doi: 10.3390/bios3030259.
Target DNA stabilizes Mycobacterium tuberculosis DevR/DosR phosphorylation by the full-length oxygen sensors DevS/DosS and DosT.
FEBS J. 2017 Nov;284(22):3954-3967. doi: 10.1111/febs.14284. Epub 2017 Oct 19.
Distal Hydrogen-bonding Interactions in Ligand Sensing and Signaling by Mycobacterium tuberculosis DosS.
J Biol Chem. 2016 Jul 29;291(31):16100-11. doi: 10.1074/jbc.M116.724815. Epub 2016 May 27.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Unique roles of DosT and DosS in DosR regulon induction and Mycobacterium tuberculosis dormancy.
Infect Immun. 2009 Aug;77(8):3258-63. doi: 10.1128/IAI.01449-08. Epub 2009 Jun 1.
DevS oxy complex stability identifies this heme protein as a gas sensor in Mycobacterium tuberculosis dormancy.
Biochemistry. 2009 Jun 30;48(25):5839-48. doi: 10.1021/bi802309y.
Heme oxygenase-1-derived carbon monoxide induces the Mycobacterium tuberculosis dormancy regulon.
J Biol Chem. 2008 Jun 27;283(26):18032-9. doi: 10.1074/jbc.M802274200. Epub 2008 Apr 9.
Mycobacterium tuberculosis senses host-derived carbon monoxide during macrophage infection.
Cell Host Microbe. 2008 May 15;3(5):323-30. doi: 10.1016/j.chom.2008.03.007.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
A distal tyrosine residue is required for ligand discrimination in DevS from Mycobacterium tuberculosis.
Biochemistry. 2008 Nov 25;47(47):12532-9. doi: 10.1021/bi801234w.
DosT and DevS are oxygen-switched kinases in Mycobacterium tuberculosis.
Protein Sci. 2007 Aug;16(8):1708-19. doi: 10.1110/ps.072897707. Epub 2007 Jun 28.
Mycobacterium tuberculosis DosS is a redox sensor and DosT is a hypoxia sensor.
Proc Natl Acad Sci U S A. 2007 Jul 10;104(28):11568-73. doi: 10.1073/pnas.0705054104. Epub 2007 Jul 3.
DevS, a heme-containing two-component oxygen sensor of Mycobacterium tuberculosis.
Biochemistry. 2007 Apr 10;46(14):4250-60. doi: 10.1021/bi602422p. Epub 2007 Mar 20.
A GAF domain in the hypoxia/NO-inducible Mycobacterium tuberculosis DosS protein binds haem.
J Mol Biol. 2005 Nov 11;353(5):929-36. doi: 10.1016/j.jmb.2005.09.011. Epub 2005 Sep 27.
DevR-DevS is a bona fide two-component system of Mycobacterium tuberculosis that is hypoxia-responsive in the absence of the DNA-binding domain of DevR.
Microbiology. 2004 Apr;150(Pt 4):865-75. doi: 10.1099/mic.0.26218-0.
Two sensor kinases contribute to the hypoxic response of Mycobacterium tuberculosis.
J Biol Chem. 2004 May 28;279(22):23082-7. doi: 10.1074/jbc.M401230200. Epub 2004 Mar 19.
Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program.
J Exp Med. 2003 Sep 1;198(5):705-13. doi: 10.1084/jem.20030205.
Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.
Proc Natl Acad Sci U S A. 2001 Jun 19;98(13):7534-9. doi: 10.1073/pnas.121172498.
Characterization of a two-component system, devR-devS, of Mycobacterium tuberculosis.
Tuber Lung Dis. 2000;80(3):141-59. doi: 10.1054/tuld.2000.0240.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.