whiB2
- Type
- protein_coding
- Name
- whiB2
- Locus Name
-
Rv3260c
- Product
-
Probable transcriptional regulatory protein WhiB-like WhiB2
- Functional Category
-
Regulatory proteins
- Location
- 3639872..3640141 (- strand)
- Gene Length
- 269 bp
- Nucleotides
-
TTGGTTCCCGAGGCGCCGGCGCCATTCGAGGAACCTCTGCCGCCGGAAGCCACCGACCAATGGCAGGACCGTGCGCTATGTGCGCAAACGGATCCCGAAGCGTTCTTCCCGGAGAAGGGCGGCTCCACGCGTGAGGCCAAGAAGATTTGCATGGGCTGCGAGGTGCGGCACGAGTGTCTGGAGTACGCCCTGGCTCATGACGAGCGGTTCGGCATCTGGGGTGGTCTTTCCGAACGCGAGCGCCGCCGCCTCAAACGCGGGATCATCTG
- Drug Resistance
- Mutations
- Function
- Acts as a transcriptional regulator. Probably redox-responsive. The apo- but not holo-form probably binds DNA (By similarity). {ECO:0000250}.; FUNCTION: The apo-form functions as a chaperone, preventing aggregation or helping in correct refolding of a number of substrates; this activity does not require ATP or the ability to bind a Fe-S cluster. Chaperone activity is insensitive to the redox state of its cysteine residues. The apo-form has no protein disulfide reductase activity. The apo-form binds to its own promoter. {ECO:0000269|PubMed:19016840, ECO:0000269|PubMed:22686939}.
- Family
-
WhiB family
- GO
-
- metal ion binding GO:0046872 molecular_function
- protein disulfide oxidoreductase activity GO:0015035 molecular_function
- DNA binding GO:0003677 molecular_function
- negative regulation of transcription, DNA-templated GO:0045892 biological_process
- cytoplasm GO:0005737 cellular_component
- protein-disulfide reductase activity GO:0047134 molecular_function
- 4 iron, 4 sulfur cluster binding GO:0051539 molecular_function
- dinitrosyl-iron complex binding GO:0035731 molecular_function
- cell redox homeostasis GO:0045454 biological_process
- InterPro
Summary
- Name
- Transcriptional regulator WhiB2 (Probable chaperone WhiB2)
- Family
- WhiB family
- Protein Sequence
-
MVPEAPAPFEEPLPPEATDQWQDRALCAQTDPEAFFPEKGGSTREAKKICMGCEVRHECLEYALAHDERFGIWGGLSERERRRLKRGII
- Mass
- 10,157 Da
- Length
- 89 Aa
Rv3260c doesn't seem to be a targeted by any drug.
Rv3260c doesn't seem to be involved in any pathway.
- WhiB2/Rv3260c, a cell division-associated protein of Mycobacterium tuberculosis H37Rv, has properties of a chaperone.
- FEBS J. 2012 Aug;279(15):2781-92. doi: 10.1111/j.1742-4658.2012.08662.x. Epub 2012 Jul 5.
- Insights into the function of the WhiB-like protein of mycobacteriophage TM4--a transcriptional inhibitor of WhiB2.
- Mol Microbiol. 2010 Aug;77(3):642-57. doi: 10.1111/j.1365-2958.2010.07235.x. Epub 2010 Jun 9.
- Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv.
- FEBS J. 2009 Jan;276(1):76-93. doi: 10.1111/j.1742-4658.2008.06755.x.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.