lrpA
- Type
- protein_coding
- Name
- lrpA
- Locus Name
-
Rv3291c
- Product
-
Probable transcriptional regulatory protein LrpA (Lrp/AsnC-family)
- Functional Category
-
Regulatory proteins
- Location
- 3671845..3672297 (- strand)
- Gene Length
- 452 bp
- Nucleotides
-
ATGAACGAGGCGCTCGACGATATCGATCGGATCCTGGTGCGCGAACTGGCCGCCGACGGACGTGCGACGCTGTCAGAGTTGGCCACGCGAGCCGGGCTGTCGGTCTCGGCGGTCCAATCGCGAGTGCGCCGGCTGGAGTCTCGTGGTGTGGTCCAGGGATATTCGGCGCGAATCAATCCCGAGGCGGTTGGGCATTTGTTGTCGGCGTTCGTGGCTATCACTCCTCTTGATCCGTCTCAACCAGATGATGCCCCCGCGCGCCTAGAACATATCGAGGAGGTCGAGTCCTGTTACTCGGTGGCCGGCGAAGAGAGCTACGTCTTGCTGGTGCGCGTCGCGTCCGCACGGGCGCTCGAGGACCTGTTGCAACGGATCCGGACAACGGCGAACGTGCGGACGCGAAGCACGATCATTCTGAACACTTTTTACAGCGATAGGCAGCATATACCATA
- Drug Resistance
- Mutations
- Function
- Unknown
- Family
-
Unknown
- GO
-
- DNA-binding transcription factor activity GO:0003700 molecular_function
- cytosol GO:0005829 cellular_component
- sequence-specific DNA binding GO:0043565 molecular_function
- InterPro
Summary
- Name
- Probable transcriptional regulatory protein LrpA (Lrp/AsnC-family)
- Family
- Unknown
- Protein Sequence
-
MNEALDDIDRILVRELAADGRATLSELATRAGLSVSAVQSRVRRLESRGVVQGYSARINPEAVGHLLSAFVAITPLDPSQPDDAPARLEHIEEVESCYSVAGEESYVLLVRVASARALEDLLQRIRTTANVRTRSTIILNTFYSDRQHIP
- Mass
- 16,511 Da
- Length
- 150 Aa
Rv3291c doesn't seem to be a targeted by any drug.
Rv3291c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.