Rv3364c
- Type
- protein_coding
- Name
- Rv3364c
- Locus Name
-
Rv3364c
- Product
-
Conserved protein
- Functional Category
-
Conserved hypotheticals
- Location
- 3774482..3774874 (- strand)
- Gene Length
- 392 bp
- Nucleotides
-
ATGAAAGCCCGCTTGCCGGACAGCCCGCTTGACTGGCTGGTGTCGAAGTTCGCCCGCGAGGTTCCCGGGGTGGCCCATGCATTGCTGGTGTCGGTCGACGGGCTTCCCGTGGCGGCCAGCGAACATCTACCACGCGAACGCGCCGATCAGTTGGCCGCGGTGACGTCCGGGCTGGCCAGCCTGGCCGGCGGCGCCGCGCAACTGTTCGACGGCGGGCAGGTGCTGCAGTCGGTGGTTGAGATGCAGAACGGCTACCTGCTGTTGATGCAGGTGGGAGACGGGTCGGCGCTGGCGGCGCTGGCCGCGACCGGATGCGATATCGGCCAGATCGGTTATGAGATGGCCATCCTTGTCGAGCGGGTGGGCGGCGTTGTTCAATCCTGCCGGCGATA
- Drug Resistance
- Mutations
- Function
- Effector protein that binds to the host serine protease cathepsin G on the macrophage cell membrane, inhibiting its enzymatic activity and the downstream activation of caspase-1-dependent apoptosis. Thus prevents macrophage pyroptosis and helps M.tuberculosis survival within host cells. {ECO:0000269|PubMed:22275911}.
- Family
-
Mycobacterial serine protease inhibitor Rv3364c family
- GO
-
- pathogenesis GO:0009405 biological_process
- host cell cytoplasm GO:0030430 cellular_component
- extracellular region GO:0005576 cellular_component
- serine-type endopeptidase inhibitor activity GO:0004867 molecular_function
- InterPro
Summary
- Name
- Serine protease inhibitor Rv3364c
- Family
- Mycobacterial serine protease inhibitor Rv3364c family
- Protein Sequence
-
MKARLPDSPLDWLVSKFAREVPGVAHALLVSVDGLPVAASEHLPRERADQLAAVTSGLASLAGGAAQLFDGGQVLQSVVEMQNGYLLLMQVGDGSALAALAATGCDIGQIGYEMAILVERVGGVVQSCRR
- Mass
- 13,440 Da
- Length
- 130 Aa
Rv3364c doesn't seem to be a targeted by any drug.
Rv3364c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Inhibition of the Plasma-Membrane-Associated Serine Protease Cathepsin G by Mycobacterium tuberculosis Rv3364c Suppresses Caspase-1 and Pyroptosis in Macrophages.
- Front Microbiol. 2012 Jan 11;2:281. doi: 10.3389/fmicb.2011.00281. eCollection 2011.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.