Rv3413c
- Type
- protein_coding
- Name
- Rv3413c
- Locus Name
-
Rv3413c
- Product
-
Unknown alanine and proline rich protein
- Functional Category
-
Conserved hypotheticals
- Location
- 3832146..3833045 (- strand)
- Gene Length
- 899 bp
- Nucleotides
-
ATGCGTGAATTTGGTAATCCCCTTGGCGATCGGCCGCCATTGGATGAGCTGGCCCGCACCGATCTGCTGCTCGACGCACTCGCCGAACGGGAGGAGGTTGACTTCGCGGATCCTCGCGATGACGCGTTGGCCGCCCTGCTCGGACAGTGGCGCGACGACTTGAGGTGGCCGCCGGCCAGTGCCCTGGTTTCACAGGACGAGGCCGTCGCCGCGTTGCGCGCCGGGGTAGCGCAACGGCGACGGGCTCGTCGCAGCCTGGCGGCCGTCGGGTCGGTGGCCGCGGCGCTGTTGGTGCTGAGCGGGTTCGGCGCCGTGGTGGCCGATGCTCGCCCCGGGGACCTGTTGTACGGCCTGCACGCGATGATGTTCAACCGATCGCGGGTCAGCGACGATCAGATCGTGCTGTCGGCCAAGGCCAATCTGGCGAAGGTCGAGCAAATGATTGCCCAAGGCCAATGGGCCGAGGCGCAGGATGAGCTGGCTGAGGTCAGCAGCACCGTGCAGGCCGTGACTGACGGTAGCCGCCGGCAGGACCTGATCAACGAGGTGAACCTGCTGAATACCAAGGTGGAGACGCGCGACCCGAACGCCACGCTGCGGCCCGGCTCGCCGTCCAACCCTGCGGCTCCGGGTTCGGTGGGAAACTCGTGGACTCCGCTGGCTCCAGTCGTCGAGCCGCCGACCCCCCCGACGCCTGCATCGGCAGCTGAACCGTCGATGTCGGCAGGCGTCTCGGAGAGCCCCATGCCGAACTCCACGTCCACGGTGGCAGCCAGCCCCAGCACGCCGTCATCAAAACCCGAGCCGGGCTCAATTGACCCCTCGTTGGAACCCGCCGACGAGGCGACGAATCCGGCGGGGCAGCCAGCACCGGAAACGCCGGTGAGTCCGACGCACTA
- Drug Resistance
- Mutations
- Function
- An anti-sigma factor for extracytoplasmic function (ECF) sigma factor SigD. ECF sigma factors are held in an inactive form by an anti-sigma factor until released by regulated intramembrane proteolysis (RIP). RIP occurs when an extracytoplasmic signal triggers a concerted proteolytic cascade to transmit information and elicit cellular responses. The membrane-spanning regulatory substrate protein is first cut extracytoplasmically (site-1 protease, S1P), then within the membrane itself (site-2 protease, S2P), while cytoplasmic proteases finish degrading the regulatory protein, liberating the sigma factor. Neither S1P nor S2P proteases have been so far identified for this anti-sigma factor.
- Family
-
Unknown
- GO
-
- extracellular region GO:0005576 cellular_component
- plasma membrane GO:0005886 cellular_component
- integral component of membrane GO:0016021 cellular_component
- InterPro
3VEP
- Name
- Anti-sigma-D factor RsdA (Regulator of SigD) (Sigma-D anti-sigma factor RsdA)
- Family
- Unknown
- Protein Sequence
-
MREFGNPLGDRPPLDELARTDLLLDALAEREEVDFADPRDDALAALLGQWRDDLRWPPASALVSQDEAVAALRAGVAQRRRARRSLAAVGSVAAALLVLSGFGAVVADARPGDLLYGLHAMMFNRSRVSDDQIVLSAKANLAKVEQMIAQGQWAEAQDELAEVSSTVQAVTDGSRRQDLINEVNLLNTKVETRDPNATLRPGSPSNPAAPGSVGNSWTPLAPVVEPPTPPTPASAAEPSMSAGVSESPMPNSTSTVAASPSTPSSKPEPGSIDPSLEPADEATNPAGQPAPETPVSPTH
- Mass
- 31,248 Da
- Length
- 299 Aa
Summary
Rv3413c doesn't seem to be a targeted by any drug.
Rv3413c doesn't seem to be involved in any pathway.
- Mycobacterium tuberculosis RsdA provides a conformational rationale for selective regulation of sigma-factor activity by proteolysis.
- Nucleic Acids Res. 2013 Mar 1;41(5):3414-23. doi: 10.1093/nar/gks1468. Epub 2013 Jan 11.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Over-expression and purification strategies for recombinant multi-protein oligomers: a case study of Mycobacterium tuberculosis sigma/anti-sigma factor protein complexes.
- Protein Expr Purif. 2010 Dec;74(2):223-30. doi: 10.1016/j.pep.2010.06.018. Epub 2010 Jul 1.
- Transcription regulation by the Mycobacterium tuberculosis alternative sigma factor SigD and its role in virulence.
- J Bacteriol. 2004 Oct;186(19):6605-16. doi: 10.1128/JB.186.19.6605-6616.2004.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.