truA
- Type
- protein_coding
- Name
- truA
- Locus Name
-
Rv3455c
- Product
-
Probable tRNA pseudouridine synthase a TruA (pseudouridylate synthase I) (pseudouridine synthase I) (uracil hydrolyase)
- Functional Category
-
Information pathways
- Location
- 3876052..3876822 (- strand)
- Gene Length
- 770 bp
- Nucleotides
-
GTGGGGCAGCGCACGGTCGCGGGCGATCTCGATGCGGCGCTGACTACCATCTTCCGCACCCCGGTGCGGCTGCGGGCGGCCGGACGCACTGATGCGGGCGTGCACGCCAGCGGCCAGGTCGCCCACGTTGACGTGCCCGCCGATGCCTTGCCGAACGCTTACCCGCGCGCCGGCCACGTCGGTGATCCGGAATTCCTGCCGCTGTTGCGGAGGCTGGGTCGATTTCTGCCCGCCGACGTTCGAATCCTCGATATCACGCGCGCACCAGCGGGTTTCGACGCCAGATTCTCGGCGCTGCGGCGGCATTACGTGTACCGGCTGTCGACAGCACCCTACGGTGTCGAGCCGCAGCAGGCGCGCTACATCACCGCTTGGCCACGCGAGCTTGATCTGGATGCGATGACGGCCGCGTCGCGAGATTTGATGGGGCTGCACGACTTCGCGGCGTTCTGCCGTCATCGCGAGGGCGCCACCACGATTCGTGATCTGCAGCGGCTGGACTGGTCGCGTGCCGGCACCCTGGTCACCGCGCACGTCACCGCCGACGCGTTCTGTTGGTCGATGGTGCGGTCGTTGGTGGGGGCGCTACTGGCGGTCGGCGAGCACCGTCGCGCGACAACTTGGTGTCGTGAGCTGCTCACCGCGACAGGACGATCCAGCGACTTCGCGGTCGCGCCGGCGCACGGGTTGACGTTGATCCAGGTGGACTATCCGCCCGATGACCAGCTCGCGTCACGGAACTTGGTCACCCGGGATGTGCGCTCGGGCTA
- Drug Resistance
- Mutations
- Function
- Formation of pseudouridine at positions 38, 39 and 40 in the anticodon stem and loop of transfer RNAs. {ECO:0000255|HAMAP-Rule:MF_00171}.
- Family
-
TRNA pseudouridine synthase TruA family
- GO
-
- pseudouridine synthase activity GO:0009982 molecular_function
- RNA binding GO:0003723 molecular_function
- cell wall GO:0005618 cellular_component
- tRNA pseudouridine synthase activity GO:0106029 molecular_function
- tRNA pseudouridine synthesis GO:0031119 biological_process
- InterPro
Summary
- Name
- tRNA pseudouridine synthase A (EC 5.4.99.12) (tRNA pseudouridine(38-40) synthase) (tRNA pseudouridylate synthase I) (tRNA-uridine isomerase I)
- Family
- TRNA pseudouridine synthase TruA family
- Protein Sequence
-
MSLTRRPPKSPPQRPPRISGVVRLRLDIAYDGTDFAGWAAQVGQRTVAGDLDAALTTIFRTPVRLRAAGRTDAGVHASGQVAHVDVPADALPNAYPRAGHVGDPEFLPLLRRLGRFLPADVRILDITRAPAGFDARFSALRRHYVYRLSTAPYGVEPQQARYITAWPRELDLDAMTAASRDLMGLHDFAAFCRHREGATTIRDLQRLDWSRAGTLVTAHVTADAFCWSMVRSLVGALLAVGEHRRATTWCRELLTATGRSSDFAVAPAHGLTLIQVDYPPDDQLASRNLVTRDVRSG
- Mass
- 32,620 Da
- Length
- 297 Aa
Rv3455c doesn't seem to be a targeted by any drug.
Rv3455c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.