Gene - combatTB X

otsA

Type: protein_coding
Name: otsA
Locus Name: Rv3490
Product: Alpha, alpha-trehalose-phosphate synthase [UDP-forming] OtsA (trehalose-6-phosphate synthase) (UDP-glucose-glucosephosphate glucosyltransferase) (trehalosephosphate-UDP glucosyltransferase) (trehalose-6-phosphate synthetase) (trehalose-phosphate synthase) (trehalose-phosphate synthetase) (transglucosylase) (trehalosephosphate-UDP glucosyl transferase)
Functional Category: Virulence, detoxification, adaptation
Location: 3908236..3909738 (+ strand)
Gene Length: 1502 bp
Nucleotides: TGGCTCCCTCGGGAGGCCAGGAGGCGCAGATTTGCGATTCGGAGACCTTCGGGGACTCTGACTTCGTGGTGGTAGCCAATCGACTGCCCGTCGATCTGGAGCGTCTTCCCGACGGCAGCACAACCTGGAAACGCAGCCCCGGAGGCTTGGTCACCGCCTTGGAGCCGGTGCTGCGGCGTCGGCGCGGGGCCTGGGTCGGCTGGCCCGGCGTTAACGACGACGGGGCCGAACCCGACCTCCACGTGCTGGACGGCCCCATCATCCAAGACGAGCTGGAACTTCATCCGGTACGGCTGAGCACCACGGACATAGCTCAGTACTACGAGGGATTCTCCAACGCCACACTGTGGCCGCTGTACCACGACGTCATCGTCAAGCCGCTCTACCACCGCGAATGGTGGGATCGCTACGTCGACGTCAACCAGCGCTTTGCCGAGGCCGCGTCGCGCGCCGCCGCCCACGGCGCAACCGTGTGGGTACAGGACTACCAGCTGCAGCTGGTACCGAAGATGCTGCGCATGCTGCGGCCCGATCTGACCATCGGTTTCTTTTTGCACATCCCGTTCCCGCCGGTAGAGCTGTTTATGCAGATGCCGTGGCGCACCGAGATCATCCAGGGCCTACTGGGCGCCGACCTGGTGGGCTTCCATCTTCCGGGCGGTGCCCAGAATTTCCTGATCCTGTCCCGGCGTCTGGTCGGCACCGACACTTCCCGCGGAACCGTCGGTGTGCGGTCGCGGTTCGGTGCGGCGGTGCTCGGGTCCCGCACCATACGAGTTGGCGCCTTTCCTATCTCGGTTGACTCCGGCGCGCTCGACCACGCTGCCCGCGACCGCAACATCAGGCGCCGGGCCCGCGAGATTCGCACCGAACTGGGAAATCCGCGCAAGATCCTGCTCGGTGTTGACCGGCTCGACTACACCAAGGGCATCGACGTACGGCTGAAGGCCTTTTCCGAGCTGCTGGCCGAGGGCCGCGTCAAACGCGACGACACCGTCGTGGTCCAGCTGGCTACCCCGAGCCGCGAGCGGGTGGAGAGCTACCAGACGCTGCGCAACGACATCGAACGCCAGGTCGGCCACATTAACGGCGAGTACGGTGAGGTTGGCCATCCGGTAGTGCATTACCTGCATCGACCGGCTCCGCGCGACGAGCTTATCGCTTTCTTCGTGGCCAGCGACGTCATGCTGGTCACCCCACTACGCGACGGGATGAACCTGGTGGCCAAGGAGTACGTCGCTTGCCGCAGCGATCTTGGCGGTGCCCTGGTGCTCAGCGAATTCACCGGGGCCGCAGCCGAACTCCGGCACGCATACCTGGTCAACCCGCACGACCTGGAAGGCGTCAAGGACGGGATAGAGGAAGCGCTCAACCAGACGGAGGAGGCGGGCCGGCGGCGAATGCGGTCGCTGCGACGCCAAGTGCTCGCCCACGACGTGGACCGCTGGGCACAGTCGTTTCTCGACGCTCTCGCCGGGGCACACCCGAGGGGCCAAGGCTAA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Involved in the production of glycogen and alpha-glucan via the TreS-Pep2 branch involved in the biosynthesis of maltose-1-phosphate (M1P), and probably in the osmoprotection via the biosynthesis of trehalose (PubMed:12473104, PubMed:27513637). Catalyzes the transfer of glucose from UDP-glucose (UDP-Glc) to D-glucose 6-phosphate (Glc-6-P) to form trehalose-6-phosphate (PubMed:12473104). Is specific for the glucosyl acceptor (Glc-6-P cannot be replaced by either mannose-6-P, fructose-6-P or glucosamine-6-P), but any of the glucose sugar nucleotides can be used as glucosyl donors (PubMed:12473104). It is more active with the purine sugar nucleotides than with the pyrimidine sugar nucleotides (PubMed:12473104). {ECO:0000269|PubMed:12473104, ECO:0000269|PubMed:27513637}.

Family

Glycosyltransferase 20 family

GO

alpha,alpha-trehalose-phosphate synthase (UDP-forming) activity GO:0003825 molecular_function
manganese ion binding GO:0030145 molecular_function
trehalose biosynthetic process GO:0005992 biological_process
cell wall GO:0005618 cellular_component
cytosol GO:0005829 cellular_component
plasma membrane GO:0005886 cellular_component
cytoplasm GO:0005737 cellular_component
alpha,alpha-trehalose-phosphate synthase (GDP-forming) activity GO:0047260 molecular_function
trehalose metabolism in response to cold stress GO:0070415 biological_process
trehalose metabolism in response to stress GO:0070413 biological_process
dephosphorylation GO:0016311 biological_process
cellular response to DNA damage stimulus GO:0006974 biological_process
response to osmotic stress GO:0006970 biological_process

InterPro

IPR001830

UniProt: P9WN11
GenBank: Rv3490
EnsemblBacteria: Rv3490
Mycobrowser: Rv3490

Summary

Name: Trehalose-6-phosphate synthase (TPS) (EC 2.4.1.15) (EC 2.4.1.347) (Alpha,alpha-trehalose-phosphate synthase [UDP-forming]) (Osmoregulatory trehalose synthesis protein A) (OtsA)
Family: Glycosyltransferase 20 family
Protein Sequence: MAPSGGQEAQICDSETFGDSDFVVVANRLPVDLERLPDGSTTWKRSPGGLVTALEPVLRRRRGAWVGWPGVNDDGAEPDLHVLDGPIIQDELELHPVRLSTTDIAQYYEGFSNATLWPLYHDVIVKPLYHREWWDRYVDVNQRFAEAASRAAAHGATVWVQDYQLQLVPKMLRMLRPDLTIGFFLHIPFPPVELFMQMPWRTEIIQGLLGADLVGFHLPGGAQNFLILSRRLVGTDTSRGTVGVRSRFGAAVLGSRTIRVGAFPISVDSGALDHAARDRNIRRRAREIRTELGNPRKILLGVDRLDYTKGIDVRLKAFSELLAEGRVKRDDTVVVQLATPSRERVESYQTLRNDIERQVGHINGEYGEVGHPVVHYLHRPAPRDELIAFFVASDVMLVTPLRDGMNLVAKEYVACRSDLGGALVLSEFTGAAAELRHAYLVNPHDLEGVKDGIEEALNQTEEAGRRRMRSLRRQVLAHDVDRWAQSFLDALAGAHPRGQG
Mass: 55,862 Da
Length: 500 Aa

Rv3490 doesn't seem to be a targeted by any drug.

Trehalose biosynthesis R-MTU-868688
Mycobacterium tuberculosis
cytosol

Starch and sucrose metabolism mtu00500
mtu00500
PATHWAY_MAP mtu00500 Starch and sucrose metabolism

Metabolic Network for the Biosynthesis of Intra- and Extracellular alpha-Glucans Required for Virulence of Mycobacterium tuberculosis.: PLoS Pathog. 2016 Aug 11;12(8):e1005768. doi: 10.1371/journal.ppat.1005768. eCollection 2016 Aug.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Trehalose-phosphate synthase of Mycobacterium tuberculosis. Cloning, expression and properties of the recombinant enzyme.: Eur J Biochem. 2002 Dec;269(24):6091-100. doi: 10.1046/j.1432-1033.2002.03327.x.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.