Gene - combatTB X

panD

Type: protein_coding
Name: panD
Locus Name: Rv3601c
Product: Probable aspartate 1-decarboxylase precursor PanD (aspartate alpha-decarboxylase)
Functional Category: Intermediary metabolism and respiration
Location: 4043862..4044281 (- strand)
Gene Length: 419 bp
Nucleotides: ATGTTACGGACGATGCTGAAGTCGAAGATCCACCGCGCCACGGTGACCTGCGCCGACCTGCACTACGTCGGCTCGGTGACCATCGATGCCGACTTGATGGACGCCGCCGACCTGCTGGAAGGCGAACAGGTAACCATCGTCGATATCGACAACGGTGCTCGACTGGTCACCTACGCGATCACCGGCGAACGCGGCAGTGGTGTGATTGGCATCAACGGTGCCGCCGCGCACTTGGTGCATCCGGGGGATCTGGTGATTCTGATTGCGTACGCGACGATGGACGACGCCCGGGCCCGCACATACCAGCCGCGGATCGTGTTTGTCGACGCTTACAACAAACCGATCGACATGGGCCACGATCCGGCATTTGTGCCCGAAAACGCGGGCGAGCTGCTAGACCCCCGGCTCGGTGTGGGATA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Catalyzes the pyruvoyl-dependent decarboxylation of aspartate to produce beta-alanine. {ECO:0000255|HAMAP-Rule:MF_00446, ECO:0000305|PubMed:12182836}.; FUNCTION: Overexpression of wild-type protein confers resistance to pyrazinoic acid (POA), the active form of the anti-tuberculosis prodrug pyrazinamide (PZA). {ECO:0000269|PubMed:26038753}.

Family

PanD family

GO

aspartate 1-decarboxylase activity GO:0004068 molecular_function
alanine biosynthetic process GO:0006523 biological_process
cytosol GO:0005829 cellular_component
cell wall GO:0005618 cellular_component
pantothenate biosynthetic process GO:0015940 biological_process
pathogenesis GO:0009405 biological_process

InterPro

UniProt: P9WIL3
GenBank: Rv3601c
EnsemblBacteria: Rv3601c
Mycobrowser: Rv3601c

Summary

Name: Aspartate 1-decarboxylase (EC 4.1.1.11) (Aspartate alpha-decarboxylase) [Cleaved into: Aspartate 1-decarboxylase beta chain; Aspartate 1-decarboxylase alpha chain]
Family: PanD family
Protein Sequence: MLRTMLKSKIHRATVTCADLHYVGSVTIDADLMDAADLLEGEQVTIVDIDNGARLVTYAITGERGSGVIGINGAAAHLVHPGDLVILIAYATMDDARARTYQPRIVFVDAYNKPIDMGHDPAFVPENAGELLDPRLGVG
Mass: 14,885 Da
Length: 139 Aa

Rv3601c doesn't seem to be a targeted by any drug.

beta-Alanine metabolism mtu00410
mtu00410
PATHWAY_MAP mtu00410 beta-Alanine metabolism

Pantothenate and CoA biosynthesis mtu00770
mtu00770
PATHWAY_MAP mtu00770 Pantothenate and CoA biosynthesis

Crystal structure of uncleaved L-aspartate-alpha-decarboxylase from Mycobacterium tuberculosis.: Proteins. 2006 Dec 1;65(4):796-802. doi: 10.1002/prot.21126.
Aspartate decarboxylase (PanD) as a new target of pyrazinamide in Mycobacterium tuberculosis.: Emerg Microbes Infect. 2014 Aug;3(8):e58. doi: 10.1038/emi.2014.61. Epub 2014 Aug 13.
Pantothenate and pantetheine antagonize the antitubercular activity of pyrazinamide.: Antimicrob Agents Chemother. 2014 Dec;58(12):7258-63. doi: 10.1128/AAC.04028-14. Epub 2014 Sep 22.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Expression, purification, and biochemical characterization of Mycobacterium tuberculosis aspartate decarboxylase, PanD.: Protein Expr Purif. 2002 Aug;25(3):533-40.
A pantothenate auxotroph of Mycobacterium tuberculosis is highly attenuated and protects mice against tuberculosis.: Nat Med. 2002 Oct;8(10):1171-4. doi: 10.1038/nm765. Epub 2002 Sep 9.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Mutations in panD encoding aspartate decarboxylase are associated with pyrazinamide resistance in Mycobacterium tuberculosis.: Emerg Microbes Infect. 2013 Jun;2(6):e34. doi: 10.1038/emi.2013.38. Epub 2013 Jun 12.