tcrX
- Type
- protein_coding
- Name
- tcrX
- Locus Name
-
Rv3765c
- Product
-
Probable two component transcriptional regulatory protein TcrX
- Functional Category
-
None
- Location
- 4211080..4211784 (- strand)
- Gene Length
- 704 bp
- Nucleotides
-
ATGCGGCGCGCCGATGGCCAACCGGTCACTGTGCTGGTGGTCGACGACGAACCCGTTCTGGCCGAGATGGTGTCCATGGCATTGCGGTATGAAGGTTGGAACATCACCACCGCCGGTGACGGATCGTCGGCGATTGCGGCGGCCCGCCGCCAGCGGCCCGATGTGGTTGTGCTCGACGTGATGTTGCCTGACATGAGCGGTCTTGACGTGCTGCACAAGTTGCGCAGCGAGAATCCAGGCCTGCCGGTTCTACTGCTGACGGCCAAGGACGCGGTGGAAGATCGTATAGCTGGGTTGACCGCGGGGGGCGACGACTACGTCACCAAGCCGTTTAGCATCGAGGAGGTCGTGCTTCGGCTGCGGGCGTTACTGCGTCGCACGGGGGTGACGACAGTCGACAGCGGTGCCCAGCTAGTGGTCGGAGACTTGGTGCTGGACGAAGACAGCCACGAGGTGATGCGCGCCGGCGAACCGGTGTCGTTGACGTCCACCGAGTTCGAGCTGCTGCGGTTCATGATGCACAACTCCAAGCGGGTGCTGAGCAAAGCCCAGATTCTGGACCGCGTCTGGAGTTACGACTTCGGCGGCCGGTCCAATATCGTGGAGCTGTACATCTCGTACCTGCGCAAAAAGATCGACAACGGTCGCGAACCCATGATTCACACGCTGCGCGGCGCCGGCTATGTGCTCAAGCCGGCCCGCTA
- Drug Resistance
- Mutations
- Function
- Member of the two-component regulatory system TcrY/TcrX. {ECO:0000269|PubMed:12595424, ECO:0000269|PubMed:19962420}.
- Family
-
Unknown
- GO
-
- cellular response to iron ion starvation GO:0010106 biological_process
- transcription regulatory region sequence-specific DNA binding GO:0000976 molecular_function
- DNA-binding transcription factor activity GO:0003700 molecular_function
- DNA-binding transcription activator activity GO:0001216 molecular_function
- protein-DNA complex GO:0032993 cellular_component
- cytosol GO:0005829 cellular_component
- phosphorelay response regulator activity GO:0000156 molecular_function
- InterPro
Summary
- Name
- Probable transcriptional regulatory protein TcrX
- Family
- Unknown
- Protein Sequence
-
MRRADGQPVTVLVVDDEPVLAEMVSMALRYEGWNITTAGDGSSAIAAARRQRPDVVVLDVMLPDMSGLDVLHKLRSENPGLPVLLLTAKDAVEDRIAGLTAGGDDYVTKPFSIEEVVLRLRALLRRTGVTTVDSGAQLVVGDLVLDEDSHEVMRAGEPVSLTSTEFELLRFMMHNSKRVLSKAQILDRVWSYDFGGRSNIVELYISYLRKKIDNGREPMIHTLRGAGYVLKPAR
- Mass
- 25,844 Da
- Length
- 234 Aa
Rv3765c doesn't seem to be a targeted by any drug.
Rv3765c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Interaction analysis of TcrX/Y two component system from Mycobacterium tuberculosis.
- Biochimie. 2010 Mar;92(3):263-72. doi: 10.1016/j.biochi.2009.11.009. Epub 2009 Dec 3.
- Deletion of two-component regulatory systems increases the virulence of Mycobacterium tuberculosis.
- Infect Immun. 2003 Mar;71(3):1134-40. doi: 10.1128/iai.71.3.1134-1140.2003.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.