Gene - combatTB X

dprE1

Type: protein_coding
Name: dprE1
Locus Name: Rv3790
Product: Decaprenylphosphoryl-beta-D-ribose 2'-oxidase
Functional Category: None
Location: 4235779..4237164 (+ strand)
Gene Length: 1385 bp
Nucleotides: TGTTGAGCGTGGGAGCTACCACTACCGCCACCCGGCTGACCGGGTGGGGCCGCACAGCGCCGTCGGTGGCGAATGTGCTTCGCACCCCAGATGCCGAGATGATCGTCAAGGCGGTGGCTCGGGTCGCCGAGTCGGGGGGCGGCCGGGGTGCTATCGCGCGCGGGCTGGGCCGCTCCTATGGGGACAACGCCCAAAACGGCGGTGGGTTGGTGATCGACATGACGCCGCTGAACACTATCCACTCCATTGACGCCGACACCAAGCTGGTCGACATCGACGCCGGGGTCAACCTCGACCAACTGATGAAAGCCGCCCTGCCGTTCGGGCTGTGGGTCCCGGTGCTGCCGGGAACCCGGCAGGTCACCGTCGGCGGGGCGATCGCCTGCGATATCCACGGCAAGAACCATCACAGCGCTGGCAGCTTCGGTAACCACGTGCGCAGCATGGACCTGCTGACCGCCGACGGCGAGATCCGTCATCTCACTCCGACCGGCGAGGACGCCGAACTGTTCTGGGCCACCGTCGGGGGCAACGGTCTCACCGGCATCATCATGCGGGCCACCATCGAGATGACGCCCACTTCGACGGCGTACTTCATCGCCGACGGCGACGTCACCGCCAGCCTCGACGAGACCATCGCCCTGCACAGCGACGGCAGCGAAGCGCGCTACACCTATTCCAGTGCCTGGTTCGACGCGATCAGCGCTCCCCCGAAGCTGGGCCGCGCGGCGGTATCGCGTGGCCGCCTGGCCACCGTCGAGCAATTGCCTGCGAAACTGCGGAGCGAACCTTTGAAATTCGATGCGCCACAGCTACTTACGTTGCCCGACGTGTTTCCCAACGGGCTGGCCAACAAATATACCTTCGGCCCGATCGGCGAACTGTGGTACCGCAAATCCGGCACCTATCGCGGCAAGGTCCAGAACCTCACGCAGTTCTACCATCCGCTGGACATGTTCGGCGAATGGAACCGCGCCTACGGCCCAGCGGGCTTCCTGCAATATCAGTTCGTGATCCCCACAGAGGCGGTTGATGAGTTCAAGAAGATCATCGGCGTTATTCAAGCCTCGGGTCACTACTCGTTTCTCAACGTGTTCAAGCTGTTCGGCCCCCGCAACCAGGCGCCGCTCAGCTTCCCCATCCCGGGCTGGAACATCTGCGTCGACTTCCCCATCAAGGACGGGCTGGGGAAGTTCGTCAGCGAACTCGACCGCCGGGTACTGGAATTCGGCGGCCGGCTCTACACCGCCAAAGACTCCCGTACCACCGCCGAAACCTTTCATGCCATGTATCCGCGCGTCGACGAATGGATCTCCGTGCGCCGCAAGGTCGATCCGCTGCGCGTATTCGCCTCCGACATGGCCCGACGCTTGGAGCTGCTGTAG
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Component of the DprE1-DprE2 complex that catalyzes the 2-step epimerization of decaprenyl-phospho-ribose (DPR) to decaprenyl-phospho-arabinose (DPA), a key precursor that serves as the arabinose donor required for the synthesis of cell-wall arabinans (PubMed:16291675, PubMed:19299584). DprE1 catalyzes the first step of epimerization, namely FAD-dependent oxidation of the C2' hydroxyl of DPR to yield the keto intermediate decaprenyl-phospho-2'-keto-D-arabinose (DPX) (PubMed:22733761). The intermediate DPX is then transferred to DprE2 subunit of the epimerase complex, most probably through a 'substrate channel' at the interface of DprE1-DprE2 complex (PubMed:25789990). Can also use farnesyl-phosphoryl-beta-D-ribofuranose (FPR) as substrate in vitro (PubMed:25427196). Appears to be essential for the growth and survival of M.tuberculosis (PubMed:12657046, PubMed:24517327). {ECO:0000269|PubMed:12657046, ECO:0000269|PubMed:16291675, ECO:0000269|PubMed:19299584, ECO:0000269|PubMed:22733761, ECO:0000269|PubMed:24517327, ECO:0000269|PubMed:25427196, ECO:0000305|PubMed:25789990}.; FUNCTION: DprE1 is a highly vulnerable and fully validated tuberculosis drug target. {ECO:0000303|PubMed:20629622, ECO:0000303|PubMed:24037308, ECO:0000303|PubMed:24245764}.

Family

DprE1 family

GO

arabinan biosynthetic process GO:0035884 biological_process
capsule polysaccharide biosynthetic process GO:0045227 biological_process
plasma membrane GO:0005886 cellular_component
periplasmic space GO:0042597 cellular_component
cell wall polysaccharide biosynthetic process GO:0070592 biological_process
D-arabinono-1,4-lactone oxidase activity GO:0003885 molecular_function
response to antibiotic GO:0046677 biological_process
cell wall organization GO:0071555 biological_process
FAD binding GO:0071949 molecular_function

InterPro

UniProt: P9WJF1
GenBank: Rv3790
EnsemblBacteria: Rv3790
Mycobrowser: Rv3790

PDB IDs:

Summary

Name: Decaprenylphosphoryl-beta-D-ribose oxidase (EC 1.1.98.3) (Decaprenylphospho-beta-D-ribofuranose 2-dehydrogenase) (Decaprenylphosphoryl-beta-D-ribofuranose 2'-epimerase subunit DprE1) (Decaprenyl-phosphoribose 2'-epimerase subunit 1) (Decaprenylphosphoryl-beta-D-ribofuranose 2'-oxidase) (Decaprenylphosphoryl-beta-D-ribose 2-epimerase flavoprotein subunit) (FAD-dependent decaprenylphosphoryl-beta-D-ribofuranose 2-oxidase)
Family: DprE1 family
Protein Sequence: MLSVGATTTATRLTGWGRTAPSVANVLRTPDAEMIVKAVARVAESGGGRGAIARGLGRSYGDNAQNGGGLVIDMTPLNTIHSIDADTKLVDIDAGVNLDQLMKAALPFGLWVPVLPGTRQVTVGGAIACDIHGKNHHSAGSFGNHVRSMDLLTADGEIRHLTPTGEDAELFWATVGGNGLTGIIMRATIEMTPTSTAYFIADGDVTASLDETIALHSDGSEARYTYSSAWFDAISAPPKLGRAAVSRGRLATVEQLPAKLRSEPLKFDAPQLLTLPDVFPNGLANKYTFGPIGELWYRKSGTYRGKVQNLTQFYHPLDMFGEWNRAYGPAGFLQYQFVIPTEAVDEFKKIIGVIQASGHYSFLNVFKLFGPRNQAPLSFPIPGWNICVDFPIKDGLGKFVSELDRRVLEFGGRLYTAKDSRTTAETFHAMYPRVDEWISVRRKVDPLRVFASDMARRLELL
Mass: 50,163 Da
Length: 461 Aa

Rv3790 doesn't seem to be a targeted by any drug.

Rv3790 doesn't seem to be involved in any pathway.

2-Carboxyquinoxalines kill mycobacterium tuberculosis through noncovalent inhibition of DprE1.: ACS Chem Biol. 2015 Mar 20;10(3):705-14. doi: 10.1021/cb5007163. Epub 2014 Dec 9.
Towards a new combination therapy for tuberculosis with next generation benzothiazinones.: EMBO Mol Med. 2014 Mar;6(3):372-83. doi: 10.1002/emmm.201303575. Epub 2014 Feb 5.
Identification of a small molecule with activity against drug-resistant and persistent tuberculosis.: Proc Natl Acad Sci U S A. 2013 Jul 2;110(27):E2510-7. doi: 10.1073/pnas.1309171110. Epub 2013 Jun 17.
Structural basis of inhibition of Mycobacterium tuberculosis DprE1 by benzothiazinone inhibitors.: Proc Natl Acad Sci U S A. 2012 Jul 10;109(28):11354-9. doi: 10.1073/pnas.1205735109. Epub 2012 Jun 25.
Structural studies of Mycobacterium tuberculosis DprE1 interacting with its inhibitors.: Drug Discov Today. 2017 Mar;22(3):526-533. doi: 10.1016/j.drudis.2016.09.014. Epub 2016 Sep 22.
Characterization of DprE1-Mediated Benzothiazinone Resistance in Mycobacterium tuberculosis.: Antimicrob Agents Chemother. 2016 Oct 21;60(11):6451-6459. doi: 10.1128/AAC.01523-16. Print 2016 Nov.
Structure, dynamics, and interaction of Mycobacterium tuberculosis (Mtb) DprE1 and DprE2 examined by molecular modeling, simulation, and electrostatic studies.: PLoS One. 2015 Mar 19;10(3):e0119771. doi: 10.1371/journal.pone.0119771. eCollection 2015.
The 8-Pyrrole-Benzothiazinones Are Noncovalent Inhibitors of DprE1 from Mycobacterium tuberculosis.: Antimicrob Agents Chemother. 2015 Aug;59(8):4446-52. doi: 10.1128/AAC.00778-15. Epub 2015 May 18.
DprE1 Is a Vulnerable Tuberculosis Drug Target Due to Its Cell Wall Localization.: ACS Chem Biol. 2015 Jul 17;10(7):1631-6. doi: 10.1021/acschembio.5b00237. Epub 2015 Apr 29.
Assessing the essentiality of the decaprenyl-phospho-d-arabinofuranose pathway in Mycobacterium tuberculosis using conditional mutants.: Mol Microbiol. 2014 Apr;92(1):194-211. doi: 10.1111/mmi.12546. Epub 2014 Mar 7.
Discovery of pyrazolopyridones as a novel class of noncovalent DprE1 inhibitor with potent anti-mycobacterial activity.: J Med Chem. 2014 Jun 12;57(11):4761-71. doi: 10.1021/jm5002937. Epub 2014 May 22.
DprE1--from the discovery to the promising tuberculosis drug target.: Curr Pharm Des. 2014;20(27):4379-403.
Azaindoles: noncovalent DprE1 inhibitors from scaffold morphing efforts, kill Mycobacterium tuberculosis and are efficacious in vivo.: J Med Chem. 2013 Dec 12;56(23):9701-8. doi: 10.1021/jm401382v. Epub 2013 Nov 21.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Genes required for mycobacterial growth defined by high density mutagenesis.: Mol Microbiol. 2003 Apr;48(1):77-84.
Decaprenylphosphoryl arabinofuranose, the donor of the D-arabinofuranosyl residues of mycobacterial arabinan, is formed via a two-step epimerization of decaprenylphosphoryl ribose.: J Bacteriol. 2005 Dec;187(23):8020-5. doi: 10.1128/JB.187.23.8020-8025.2005.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.: BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
High content screening identifies decaprenyl-phosphoribose 2' epimerase as a target for intracellular antimycobacterial inhibitors.: PLoS Pathog. 2009 Oct;5(10):e1000645. doi: 10.1371/journal.ppat.1000645. Epub 2009 Oct 30.
Benzothiazinones kill Mycobacterium tuberculosis by blocking arabinan synthesis.: Science. 2009 May 8;324(5928):801-4. doi: 10.1126/science.1171583. Epub 2009 Mar 19.
Decaprenylphosphoryl-beta-D-ribose 2'-epimerase from Mycobacterium tuberculosis is a magic drug target.: Curr Med Chem. 2010;17(27):3099-108.
Benzothiazinones: prodrugs that covalently modify the decaprenylphosphoryl-beta-D-ribose 2'-epimerase DprE1 of Mycobacterium tuberculosis.: J Am Chem Soc. 2010 Oct 6;132(39):13663-5. doi: 10.1021/ja106357w.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
The DprE1 enzyme, one of the most vulnerable targets of Mycobacterium tuberculosis.: Appl Microbiol Biotechnol. 2013 Oct;97(20):8841-8. doi: 10.1007/s00253-013-5218-x. Epub 2013 Sep 14.