Gene - combatTB X

bfrB

Type: protein_coding
Name: bfrB
Locus Name: Rv3841
Product: Bacterioferritin BfrB
Functional Category: None
Location: 4314178..4314723 (+ strand)
Gene Length: 545 bp
Nucleotides: TGACAGAATACGAAGGGCCTAAGACAAAATTCCACGCGTTAATGCAGGAACAGATTCATAACGAATTCACAGCGGCACAACAATATGTCGCGATCGCGGTTTATTTCGACAGCGAAGACCTGCCGCAGTTGGCGAAGCATTTTTACAGCCAAGCGGTCGAGGAACGAAACCATGCAATGATGCTCGTGCAACACCTGCTCGACCGCGACCTTCGTGTCGAAATTCCCGGCGTAGACACGGTGCGAAACCAGTTCGACAGACCCCGCGAGGCACTGGCGCTGGCGCTCGATCAGGAACGCACAGTCACCGACCAGGTCGGTCGGCTGACAGCGGTGGCCCGCGACGAGGGCGATTTCCTCGGCGAGCAGTTCATGCAGTGGTTCTTGCAGGAACAGATCGAAGAGGTGGCCTTGATGGCAACCCTGGTGCGGGTTGCCGATCGGGCCGGGGCCAACCTGTTCGAGCTAGAGAACTTCGTCGCACGTGAAGTGGATGTGGCGCCGGCCGCATCAGGCGCCCCGCACGCTGCCGGGGGCCGCCTCTAG
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Iron-storage protein that displays ferroxidase activity, catalyzing the oxidation of Fe(2+) ions into Fe(3+) ions, that can then be deposited as a ferric-oxide mineral core within the central cavity of the protein complex. {ECO:0000269|PubMed:21494619}.

Family

Ferritin family, Prokaryotic subfamily

GO

intracellular sequestering of iron ion GO:0006880 biological_process
ferroxidase activity GO:0004322 molecular_function
siderophore-dependent iron import into cell GO:0033214 biological_process
ferric iron binding GO:0008199 molecular_function
ferrous iron binding GO:0008198 molecular_function
response to nitrosative stress GO:0051409 biological_process
response to hypoxia GO:0001666 biological_process
cytoplasm GO:0005737 cellular_component
plasma membrane GO:0005886 cellular_component
identical protein binding GO:0042802 molecular_function
cytosol GO:0005829 cellular_component
iron ion binding GO:0005506 molecular_function
extracellular region GO:0005576 cellular_component
cell wall GO:0005618 cellular_component

InterPro

UniProt: P9WNE5
GenBank: Rv3841
EnsemblBacteria: Rv3841
Mycobrowser: Rv3841

Summary

Name: Ferritin BfrB (EC 1.16.3.1) (Non-heme ferritin Ftn) (Nox19)
Family: Ferritin family, Prokaryotic subfamily
Protein Sequence: MTEYEGPKTKFHALMQEQIHNEFTAAQQYVAIAVYFDSEDLPQLAKHFYSQAVEERNHAMMLVQHLLDRDLRVEIPGVDTVRNQFDRPREALALALDQERTVTDQVGRLTAVARDEGDFLGEQFMQWFLQEQIEEVALMATLVRVADRAGANLFELENFVAREVDVAPAASGAPHAAGGRL
Mass: 20,442 Da
Length: 181 Aa

Rv3841 doesn't seem to be a targeted by any drug.

Porphyrin and chlorophyll metabolism mtu00860
mtu00860
PATHWAY_MAP mtu00860 Porphyrin and chlorophyll metabolism

Mtb iron assimilation by chelation R-HSA-1222449
Homo sapiens
R-HSA-1222449

Ferritin structure from Mycobacterium tuberculosis: comparative study with homologues identifies extended C-terminus involved in ferroxidase activity.: PLoS One. 2011 Apr 8;6(4):e18570. doi: 10.1371/journal.pone.0018570.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Crystallization and preliminary X-ray crystallographic analysis of a Mycobacterium tuberculosis ferritin homolog, BfrB.: Acta Crystallogr Sect F Struct Biol Cryst Commun. 2010 Dec 1;66(Pt 12):1657-61. doi: 10.1107/S1744309110042958. Epub 2010 Nov 26.
Mycobacterium tuberculosis senses host-derived carbon monoxide during macrophage infection.: Cell Host Microbe. 2008 May 15;3(5):323-30. doi: 10.1016/j.chom.2008.03.007.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Response to reactive nitrogen intermediates in Mycobacterium tuberculosis: induction of the 16-kilodalton alpha-crystallin homolog by exposure to nitric oxide donors.: Infect Immun. 1999 Jan;67(1):460-5.
Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.: Proc Natl Acad Sci U S A. 2001 Jun 19;98(13):7534-9. doi: 10.1073/pnas.121172498.
Hypoxic response of Mycobacterium tuberculosis studied by metabolic labeling and proteome analysis of cellular and extracellular proteins.: J Bacteriol. 2002 Jul;184(13):3485-91. doi: 10.1128/jb.184.13.3485-3491.2002.
ideR, An essential gene in mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response.: Infect Immun. 2002 Jul;70(7):3371-81. doi: 10.1128/iai.70.7.3371-3381.2002.