- Type
- protein_coding
- Name
- esxB
- Locus Name
-
Rv3874
- Product
-
10 kDa culture filtrate antigen EsxB (LHP) (CFP10)
- Functional Category
-
None
- Location
-
4352274..4352576
(+ strand)
- Gene Length
-
302
bp
- Nucleotides
-
TGGCAGAGATGAAGACCGATGCCGCTACCCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACCAGGTGGAGTCGACGGCAGGTTCGTTGCAGGGCCAGTGGCGCGGCGCGGCGGGGACGGCCGCCCAGGCCGCGGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGA
- Drug Resistance
-
Check for drug resistance
association at TBDREAMDB
- Mutations
-
Check for mutants available at
TARGET
- Function
- A secreted protein. Acts as a strong host (human) T-cell antigen (PubMed:11940590). Involved in translocation of bacteria from the host (human) phagolysosome to the host cytoplasm (PubMed:17604718). Might serve as a chaperone to prevent uncontrolled membrane lysis by its partner EsxA; native protein binds poorly to artificial liposomes in the absence or presence of EsxA (PubMed:17557817, PubMed:26260636). EsxA and EsxA-EsxB are cytotoxic to pneumocytes (PubMed:19906174). EsxB (and EsxA-EsxB but not EsxA alone) activates human neutrophils; EsxB transiently induces host (human) intracellular Ca(2+) mobility in a dose-dependent manner, monocytes and lymphocytes do not respond (PubMed:25332123). Neutrophils respond to EsxB by chemotaxis and primed neutrophils treated with EsxB produce reactive oxygen species (ROS); Ca(2+) release and the ROS burst via are induced by an unidentified G-protein coupled receptor (PubMed:25332123). May help regulate assembly and function of the type VII secretion system (T7SS) (PubMed:25865481). {ECO:0000269|PubMed:11940590, ECO:0000269|PubMed:17557817, ECO:0000269|PubMed:17604718, ECO:0000269|PubMed:19906174, ECO:0000269|PubMed:25332123, ECO:0000269|PubMed:25865481, ECO:0000305|PubMed:26260636}.
- Family
-
WXG100 family, CFP-10 subfamily
- GO
-
- InterPro
-
1WA8
-
- Name
-
ESAT-6-like protein EsxB (10 kDa culture filtrate antigen CFP-10) (CFP-10) (Secreted antigenic protein MTSA-10)
- Family
-
WXG100 family, CFP-10 subfamily
- Protein
Sequence
-
MAEMKTDAATLAQEAGNFERISGDLKTQIDQVESTAGSLQGQWRGAAGTAAQAAVVRFQEAANKQKQELDEISTNIRQAGVQYSRADEEQQQALSSQMGF
-
Mass
-
10,794
Da
-
Length
-
100
Aa
Rv3874 doesn't seem to be a targeted by any
drug.
Rv3874 doesn't seem to be involved in any
pathway.
-
WXG100 protein superfamily consists of three subfamilies and exhibits an alpha-helical C-terminal conserved residue pattern.
- PLoS One. 2014 Feb 26;9(2):e89313. doi: 10.1371/journal.pone.0089313. eCollection 2014.
-
Structure and function of the complex formed by the tuberculosis virulence factors CFP-10 and ESAT-6.
- EMBO J. 2005 Jul 20;24(14):2491-8. doi: 10.1038/sj.emboj.7600732. Epub 2005 Jun 23.
-
Stoichiometric protein complex formation and over-expression using the prokaryotic native operon structure.
- FEBS Lett. 2010 Feb 19;584(4):669-74. doi: 10.1016/j.febslet.2009.12.057. Epub 2010 Jan 18.
-
Two distinct conformational states of Mycobacterium tuberculosis virulent factor early secreted antigenic target 6 kDa are behind the discrepancy around its biological functions.
- FEBS J. 2015 Nov;282(21):4114-29. doi: 10.1111/febs.13408. Epub 2015 Aug 28.
-
Substrates Control Multimerization and Activation of the Multi-Domain ATPase Motor of Type VII Secretion.
- Cell. 2015 Apr 23;161(3):501-512. doi: 10.1016/j.cell.2015.03.040. Epub 2015 Apr 9.
-
CFP-10 from Mycobacterium tuberculosis selectively activates human neutrophils through a pertussis toxin-sensitive chemotactic receptor.
- Infect Immun. 2015 Jan;83(1):205-13. doi: 10.1128/IAI.02493-14. Epub 2014 Oct 20.
-
The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (beta2M) affecting antigen presentation function of macrophage.
- PLoS Pathog. 2014 Oct 30;10(10):e1004446. doi: 10.1371/journal.ppat.1004446. eCollection 2014 Oct.
-
Mycobacterium tuberculosis ESAT-6 exhibits a unique membrane-interacting activity that is not found in its ortholog from non-pathogenic Mycobacterium smegmatis.
- J Biol Chem. 2012 Dec 28;287(53):44184-91. doi: 10.1074/jbc.M112.420869. Epub 2012 Nov 13.
-
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
-
Potential role for ESAT6 in dissemination of M. tuberculosis via human lung epithelial cells.
- Mol Microbiol. 2010 Jan;75(1):92-106. doi: 10.1111/j.1365-2958.2009.06959.x. Epub 2009 Nov 10.
-
Conservation of structure and protein-protein interactions mediated by the secreted mycobacterial proteins EsxA, EsxB, and EspA.
- J Bacteriol. 2010 Jan;192(1):326-35. doi: 10.1128/JB.01032-09.
-
Systematic genetic nomenclature for type VII secretion systems.
- PLoS Pathog. 2009 Oct;5(10):e1000507. doi: 10.1371/journal.ppat.1000507. Epub 2009 Oct 30.
-
ESAT-6 inhibits production of IFN-gamma by Mycobacterium tuberculosis-responsive human T cells.
- J Immunol. 2009 Mar 15;182(6):3668-77. doi: 10.4049/jimmunol.0803579.
-
A protein linkage map of the ESAT-6 secretion system 1 (ESX-1) of Mycobacterium tuberculosis.
- Microbiol Res. 2009;164(3):253-9. doi: 10.1016/j.micres.2006.11.016. Epub 2007 Apr 12.
-
ESAT-6 from Mycobacterium tuberculosis dissociates from its putative chaperone CFP-10 under acidic conditions and exhibits membrane-lysing activity.
- J Bacteriol. 2007 Aug;189(16):6028-34. doi: 10.1128/JB.00469-07. Epub 2007 Jun 8.
-
M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells.
- Cell. 2007 Jun 29;129(7):1287-98. doi: 10.1016/j.cell.2007.05.059.
-
C-terminal signal sequence promotes virulence factor secretion in Mycobacterium tuberculosis.
- Science. 2006 Sep 15;313(5793):1632-6. doi: 10.1126/science.1131167.
-
Dissection of ESAT-6 system 1 of Mycobacterium tuberculosis and impact on immunogenicity and virulence.
- Infect Immun. 2006 Jan;74(1):88-98. doi: 10.1128/IAI.74.1.88-98.2006.
-
Functional analysis of early secreted antigenic target-6, the dominant T-cell antigen of Mycobacterium tuberculosis, reveals key residues involved in secretion, complex formation, virulence, and immunogenicity.
- J Biol Chem. 2005 Oct 7;280(40):33953-9. doi: 10.1074/jbc.M503515200. Epub 2005 Jul 27.
-
Mutually dependent secretion of proteins required for mycobacterial virulence.
- Proc Natl Acad Sci U S A. 2005 Jul 26;102(30):10676-81. doi: 10.1073/pnas.0504922102. Epub 2005 Jul 19.
-
CFP10 discriminates between nonacetylated and acetylated ESAT-6 of Mycobacterium tuberculosis by differential interaction.
- Proteomics. 2004 Oct;4(10):2954-60. doi: 10.1002/pmic.200400906.
-
Individual RD1-region genes are required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis.
- Mol Microbiol. 2004 Jan;51(2):359-70. doi: 10.1046/j.1365-2958.2003.03844.x.
-
Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system.
- Proc Natl Acad Sci U S A. 2003 Oct 28;100(22):13001-6. doi: 10.1073/pnas.2235593100. Epub 2003 Oct 13.
-
The primary mechanism of attenuation of bacillus Calmette-Guerin is a loss of secreted lytic function required for invasion of lung interstitial tissue.
- Proc Natl Acad Sci U S A. 2003 Oct 14;100(21):12420-5. doi: 10.1073/pnas.1635213100. Epub 2003 Oct 13.
-
Conclusive evidence that the major T-cell antigens of the Mycobacterium tuberculosis complex ESAT-6 and CFP-10 form a tight, 1:1 complex and characterization of the structural properties of ESAT-6, CFP-10, and the ESAT-6*CFP-10 complex. Implications for pathogenesis and virulence.
- J Biol Chem. 2002 Jun 14;277(24):21598-603. doi: 10.1074/jbc.M201625200. Epub 2002 Apr 8.
-
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
-
A Mycobacterium tuberculosis operon encoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10).
- Microbiology. 1998 Nov;144 ( Pt 11):3195-203. doi: 10.1099/00221287-144-11-3195.