esxA



Type
protein_coding
Name
esxA
Locus Name

Rv3875

Product

6 kDa early secretory antigenic target EsxA (ESAT-6)

Functional Category

None

Location
4352609..4352896 (+ strand)
Gene Length
287 bp
Nucleotides
TGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGCGAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGATGTTCGCATAG
Drug Resistance

Check for drug resistance association at TBDREAMDB

Mutations

Check for mutants available at TARGET


Function
A secreted protein that plays a number of roles in modulating the host's immune response to infection as well as being responsible for bacterial escape into the host cytoplasm. Acts as a strong host (human) T-cell antigen (PubMed:7729876, PubMed:11940590). Inhibits IL-12 p40 (IL12B) and TNF-alpha expression by infected host (mouse) macrophages, reduces the nitric oxide response by about 75% (PubMed:14557536). In mice previously exposed to the bacterium, elicits high level of IFN-gamma production by T-cells upon subsequent challenge by M.tuberculosis, in the first phase of a protective immune response (PubMed:7897219, PubMed:7729876). Higher levels (1.6-3.3 uM) of recombinant protein inhibit IFN-gamma production by host (human) T-cells and also IL-17 and TNF-alpha production but not IL-2; decreases expression of host ATF-2 and JUN transcription factors by affecting T-cell receptors signaling downstream of ZAP70, without cytotoxicity or apoptosis (PubMed:19265145). EsxA inhibits IFN-gamma production in human T-cells by activating p38 MAPK (MAPK14), p38 MAPK is not responsible for IL-17 decrease (PubMed:21586573). Binds host (mouse) Toll-like receptor 2 (TLR2) and decreases host MYD88-dependent signaling; binding to TLR2 activates host kinase AKT and subsequently inhibits downstream activation of NF-kappa-B; the C-terminal 20 residues (76-95) are necessary and sufficient for the TLR2 inhibitory effect (PubMed:17486091). Required for induction of host (human) IL-1B maturation and release by activating the host NLRP3/ASC inflammasome; may also promote access of other tuberculosis proteins to the host cells cytoplasm (PubMed:20148899). Induces IL-8 (CXCL8) expression in host (human) lung epithelial cells (PubMed:23867456). Exogenously applied protein, or protein expressed in host (human and mouse), binds beta-2-microglobulin (B2M) and decreases its export to the cell surface, probably leading to defects in class I antigen presentation by the host cell (PubMed:25356553). Responsible for mitochondrial fragmention, redistribution around the cell nucleus and decreased mitochondrial mass; this effect is not seen until 48 hours post-infection (PubMed:26092385). Able to disrupt artificial planar bilayers in the absence of EsxB (CFP-10) (PubMed:14557547). Native protein binds artificial liposomes in the absence but not presence of EsxB and is able to rigidify and lyse them; the EsxA-EsxB complex dissociates at acidic pH, EsxB might serve as a chaperone to prevent membrane lysis (PubMed:17557817). Recombinant protein induces leakage of phosphocholine liposomes at acidic pH in the absence of ExsB, undergoes conformational change, becoming more alpha-helical at acidic pH (PubMed:23150662, PubMed:25645924). The study using recombinant protein did not find dissociation of EsxA-EsxB complex at acidic pH (PubMed:23150662). Involved in translocation of bacteria from the host (human) phagolysosome to the host cytoplasm (PubMed:17604718, PubMed:22319448). Translocation into host cytoplasm is visible 3 days post-infection using cultured human cells and precedes host cell death (PubMed:22319448). Recombinant protein induces apoptosis in host (human) differentiated cell lines, which is cell-line dependent; bacteria missing the ESX-1 locus do not induce apoptosis (PubMed:17298391). Host (human) cells treated with EsxA become permeable to extracellular dye (PubMed:17298391). EsxA and EsxA-EsxB are cytotoxic to pneumocytes (PubMed:19906174). ESX-1 secretion system-induced host (mouse) cell apoptosis, which is probably responsible for infection of new host cells, might be due to EsxA (PubMed:23848406). EsxA induces necrosis in aged neutrophils (PubMed:25321481). May help regulate assembly and function of the type VII secretion system (T7SS) (By similarity). EsxA disassembles pre-formed EccC-EsxB multimers, possibly by making EccC-EsxA-EsxB trimers instead of EccC-EsxB-EsxB-EccC tetramers (By similarity). {ECO:0000250|UniProtKB:D1A4H1, ECO:0000269|PubMed:11940590, ECO:0000269|PubMed:14557536, ECO:0000269|PubMed:14557547, ECO:0000269|PubMed:17298391, ECO:0000269|PubMed:17486091, ECO:0000269|PubMed:17557817, ECO:0000269|PubMed:17604718, ECO:0000269|PubMed:19265145, ECO:0000269|PubMed:19906174, ECO:0000269|PubMed:20148899, ECO:0000269|PubMed:21586573, ECO:0000269|PubMed:22319448, ECO:0000269|PubMed:23867456, ECO:0000269|PubMed:25321481, ECO:0000269|PubMed:25356553, ECO:0000269|PubMed:26092385, ECO:0000269|PubMed:26260636, ECO:0000269|PubMed:7729876, ECO:0000269|PubMed:7897219, ECO:0000305|PubMed:23848406}.; FUNCTION: May be critical in pro-bacteria versus pro-host interactions; ESX-1 mediates DNA mediated export (maybe via EsxA). The DNA interacts with host (human) cGAS, leading to cGAMP production and activation of the host STING-TBK-1-IRF-3 signaling pathway that leads to IFN-beta which is thought to be "pro-bacteria". Mycobacterial dsDNA also interacts with AIM2-NLRP3-ASC to activate an inflammasome, leading to the "pro-host" IL-1-beta (PubMed:26048138, PubMed:26048136). {ECO:0000269|PubMed:26048136, ECO:0000269|PubMed:26048138}.
Family

WXG100 family, ESAT-6 subfamily

GO
InterPro

UniProt
P9WNK7
GenBank
Rv3875
EnsemblBacteria
Rv3875
Mycobrowser
Rv3875


1WA8
Summary
Name
6 kDa early secretory antigenic target (ESAT-6)
Family
WXG100 family, ESAT-6 subfamily
Protein Sequence
MTEQQWNFAGIEAAASAIQGNVTSIHSLLDEGKQSLTKLAAAWGGSGSEAYQGVQQKWDATATELNNALQNLARTISEAGQAMASTEGNVTGMFA
Mass
9,904 Da
Length
95 Aa

Rv3875 doesn't seem to be a targeted by any drug.


  • Tuberculosis

    Tuberculosis mtu05152

    mtu05152

    Human Diseases; Infectious disease: bacterial


WXG100 protein superfamily consists of three subfamilies and exhibits an alpha-helical C-terminal conserved residue pattern.
PLoS One. 2014 Feb 26;9(2):e89313. doi: 10.1371/journal.pone.0089313. eCollection 2014.
Structure and function of the complex formed by the tuberculosis virulence factors CFP-10 and ESAT-6.
EMBO J. 2005 Jul 20;24(14):2491-8. doi: 10.1038/sj.emboj.7600732. Epub 2005 Jun 23.
Stoichiometric protein complex formation and over-expression using the prokaryotic native operon structure.
FEBS Lett. 2010 Feb 19;584(4):669-74. doi: 10.1016/j.febslet.2009.12.057. Epub 2010 Jan 18.
Mechanism of ESAT-6 membrane interaction and its roles in pathogenesis of Mycobacterium tuberculosis.
Toxicon. 2016 Jun 15;116:29-34. doi: 10.1016/j.toxicon.2015.10.003. Epub 2015 Oct 9.
Characterization of differential pore-forming activities of ESAT-6 proteins from Mycobacterium tuberculosis and Mycobacterium smegmatis.
FEBS Lett. 2016 Feb;590(4):509-19. doi: 10.1002/1873-3468.12072. Epub 2016 Feb 7.
Two distinct conformational states of Mycobacterium tuberculosis virulent factor early secreted antigenic target 6 kDa are behind the discrepancy around its biological functions.
FEBS J. 2015 Nov;282(21):4114-29. doi: 10.1111/febs.13408. Epub 2015 Aug 28.
Infection of A549 human type II epithelial cells with Mycobacterium tuberculosis induces changes in mitochondrial morphology, distribution and mass that are dependent on the early secreted antigen, ESAT-6.
Microbes Infect. 2015 Oct;17(10):689-97. doi: 10.1016/j.micinf.2015.06.003. Epub 2015 Jun 16.
The Cytosolic Sensor cGAS Detects Mycobacterium tuberculosis DNA to Induce Type I Interferons and Activate Autophagy.
Cell Host Microbe. 2015 Jun 10;17(6):811-819. doi: 10.1016/j.chom.2015.05.004. Epub 2015 Jun 2.
Mycobacterium tuberculosis Differentially Activates cGAS- and Inflammasome-Dependent Intracellular Immune Responses through ESX-1.
Cell Host Microbe. 2015 Jun 10;17(6):799-810. doi: 10.1016/j.chom.2015.05.003. Epub 2015 Jun 2.
Characterization of Mycobacterium tuberculosis EsxA membrane insertion: roles of N- and C-terminal flexible arms and central helix-turn-helix motif.
J Biol Chem. 2015 Mar 13;290(11):7314-22. doi: 10.1074/jbc.M114.622076. Epub 2015 Feb 2.
The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (beta2M) affecting antigen presentation function of macrophage.
PLoS Pathog. 2014 Oct 30;10(10):e1004446. doi: 10.1371/journal.ppat.1004446. eCollection 2014 Oct.
Mycobacterium tuberculosis ESAT-6 is a leukocidin causing Ca2+ influx, necrosis and neutrophil extracellular trap formation.
Cell Death Dis. 2014 Oct 16;5:e1474. doi: 10.1038/cddis.2014.394.
Anticytolytic screen identifies inhibitors of mycobacterial virulence protein secretion.
Cell Host Microbe. 2014 Oct 8;16(4):538-48. doi: 10.1016/j.chom.2014.09.008.
Early secreted antigenic target of 6 kDa (ESAT-6) protein of Mycobacterium tuberculosis induces interleukin-8 (IL-8) expression in lung epithelial cells via protein kinase signaling and reactive oxygen species.
J Biol Chem. 2013 Aug 30;288(35):25500-11. doi: 10.1074/jbc.M112.448217. Epub 2013 Jul 18.
ESX-1-induced apoptosis is involved in cell-to-cell spread of Mycobacterium tuberculosis.
Cell Microbiol. 2013 Dec;15(12):1994-2005. doi: 10.1111/cmi.12169. Epub 2013 Aug 2.
Mycobacterium tuberculosis ESAT-6 exhibits a unique membrane-interacting activity that is not found in its ortholog from non-pathogenic Mycobacterium smegmatis.
J Biol Chem. 2012 Dec 28;287(53):44184-91. doi: 10.1074/jbc.M112.420869. Epub 2012 Nov 13.
ESX-1-mediated translocation to the cytosol controls virulence of mycobacteria.
Cell Microbiol. 2012 Aug;14(8):1287-98. doi: 10.1111/j.1462-5822.2012.01799.x. Epub 2012 May 8.
Phagosomal rupture by Mycobacterium tuberculosis results in toxicity and host cell death.
PLoS Pathog. 2012 Feb;8(2):e1002507. doi: 10.1371/journal.ppat.1002507. Epub 2012 Feb 2.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
The Mycobacterium tuberculosis early secreted antigenic target of 6 kDa inhibits T cell interferon-gamma production through the p38 mitogen-activated protein kinase pathway.
J Biol Chem. 2011 Jul 8;286(27):24508-18. doi: 10.1074/jbc.M111.234062. Epub 2011 May 17.
Mycobacterium tuberculosis protein ESAT-6 is a potent activator of the NLRP3/ASC inflammasome.
Cell Microbiol. 2010 Aug;12(8):1046-63. doi: 10.1111/j.1462-5822.2010.01450.x. Epub 2010 Feb 9.
Potential role for ESAT6 in dissemination of M. tuberculosis via human lung epithelial cells.
Mol Microbiol. 2010 Jan;75(1):92-106. doi: 10.1111/j.1365-2958.2009.06959.x. Epub 2009 Nov 10.
Conservation of structure and protein-protein interactions mediated by the secreted mycobacterial proteins EsxA, EsxB, and EspA.
J Bacteriol. 2010 Jan;192(1):326-35. doi: 10.1128/JB.01032-09.
Non-acylated Mycobacterium bovis glycoprotein MPB83 binds to TLR1/2 and stimulates production of matrix metalloproteinase 9.
Biochem Biophys Res Commun. 2010 Sep 24;400(3):403-8. doi: 10.1016/j.bbrc.2010.08.085. Epub 2010 Aug 26.
Systematic genetic nomenclature for type VII secretion systems.
PLoS Pathog. 2009 Oct;5(10):e1000507. doi: 10.1371/journal.ppat.1000507. Epub 2009 Oct 30.
ESX-1 secreted virulence factors are recognized by multiple cytosolic AAA ATPases in pathogenic mycobacteria.
Mol Microbiol. 2009 Sep;73(5):950-62. doi: 10.1111/j.1365-2958.2009.06821.x. Epub 2009 Aug 4.
ESAT-6 inhibits production of IFN-gamma by Mycobacterium tuberculosis-responsive human T cells.
J Immunol. 2009 Mar 15;182(6):3668-77. doi: 10.4049/jimmunol.0803579.
ESAT-6 from Mycobacterium tuberculosis dissociates from its putative chaperone CFP-10 under acidic conditions and exhibits membrane-lysing activity.
J Bacteriol. 2007 Aug;189(16):6028-34. doi: 10.1128/JB.00469-07. Epub 2007 Jun 8.
M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells.
Cell. 2007 Jun 29;129(7):1287-98. doi: 10.1016/j.cell.2007.05.059.
Direct extracellular interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2 inhibits TLR signaling in macrophages.
Nat Immunol. 2007 Jun;8(6):610-8. doi: 10.1038/ni1468. Epub 2007 May 7.
The ESAT6 protein of Mycobacterium tuberculosis induces apoptosis of macrophages by activating caspase expression.
Cell Microbiol. 2007 Jun;9(6):1547-55. doi: 10.1111/j.1462-5822.2007.00892.x. Epub 2007 Feb 9.
C-terminal signal sequence promotes virulence factor secretion in Mycobacterium tuberculosis.
Science. 2006 Sep 15;313(5793):1632-6. doi: 10.1126/science.1131167.
Dissection of ESAT-6 system 1 of Mycobacterium tuberculosis and impact on immunogenicity and virulence.
Infect Immun. 2006 Jan;74(1):88-98. doi: 10.1128/IAI.74.1.88-98.2006.
Functional analysis of early secreted antigenic target-6, the dominant T-cell antigen of Mycobacterium tuberculosis, reveals key residues involved in secretion, complex formation, virulence, and immunogenicity.
J Biol Chem. 2005 Oct 7;280(40):33953-9. doi: 10.1074/jbc.M503515200. Epub 2005 Jul 27.
Mutually dependent secretion of proteins required for mycobacterial virulence.
Proc Natl Acad Sci U S A. 2005 Jul 26;102(30):10676-81. doi: 10.1073/pnas.0504922102. Epub 2005 Jul 19.
Individual RD1-region genes are required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis.
Mol Microbiol. 2004 Jan;51(2):359-70. doi: 10.1046/j.1365-2958.2003.03844.x.
Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system.
Proc Natl Acad Sci U S A. 2003 Oct 28;100(22):13001-6. doi: 10.1073/pnas.2235593100. Epub 2003 Oct 13.
The primary mechanism of attenuation of bacillus Calmette-Guerin is a loss of secreted lytic function required for invasion of lung interstitial tissue.
Proc Natl Acad Sci U S A. 2003 Oct 14;100(21):12420-5. doi: 10.1073/pnas.1635213100. Epub 2003 Oct 13.
Conclusive evidence that the major T-cell antigens of the Mycobacterium tuberculosis complex ESAT-6 and CFP-10 form a tight, 1:1 complex and characterization of the structural properties of ESAT-6, CFP-10, and the ESAT-6*CFP-10 complex. Implications for pathogenesis and virulence.
J Biol Chem. 2002 Jun 14;277(24):21598-603. doi: 10.1074/jbc.M201625200. Epub 2002 Apr 8.
CFP10 discriminates between nonacetylated and acetylated ESAT-6 of Mycobacterium tuberculosis by differential interaction.
Proteomics. 2004 Oct;4(10):2954-60. doi: 10.1002/pmic.200400906.
A Mycobacterium tuberculosis operon encoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10).
Microbiology. 1998 Nov;144 ( Pt 11):3195-203. doi: 10.1099/00221287-144-11-3195.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis.
Infect Immun. 1995 May;63(5):1710-7.
Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice.
J Immunol. 1995 Apr 1;154(7):3359-72.