- Type
- protein_coding
- Name
- esxA
- Locus Name
-
Rv3875
- Product
-
6 kDa early secretory antigenic target EsxA (ESAT-6)
- Functional Category
-
None
- Location
-
4352609..4352896
(+ strand)
- Gene Length
-
287
bp
- Nucleotides
-
TGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGCGAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGATGTTCGCATAG
- Drug Resistance
-
Check for drug resistance
association at TBDREAMDB
- Mutations
-
Check for mutants available at
TARGET
- Function
- A secreted protein that plays a number of roles in modulating the host's immune response to infection as well as being responsible for bacterial escape into the host cytoplasm. Acts as a strong host (human) T-cell antigen (PubMed:7729876, PubMed:11940590). Inhibits IL-12 p40 (IL12B) and TNF-alpha expression by infected host (mouse) macrophages, reduces the nitric oxide response by about 75% (PubMed:14557536). In mice previously exposed to the bacterium, elicits high level of IFN-gamma production by T-cells upon subsequent challenge by M.tuberculosis, in the first phase of a protective immune response (PubMed:7897219, PubMed:7729876). Higher levels (1.6-3.3 uM) of recombinant protein inhibit IFN-gamma production by host (human) T-cells and also IL-17 and TNF-alpha production but not IL-2; decreases expression of host ATF-2 and JUN transcription factors by affecting T-cell receptors signaling downstream of ZAP70, without cytotoxicity or apoptosis (PubMed:19265145). EsxA inhibits IFN-gamma production in human T-cells by activating p38 MAPK (MAPK14), p38 MAPK is not responsible for IL-17 decrease (PubMed:21586573). Binds host (mouse) Toll-like receptor 2 (TLR2) and decreases host MYD88-dependent signaling; binding to TLR2 activates host kinase AKT and subsequently inhibits downstream activation of NF-kappa-B; the C-terminal 20 residues (76-95) are necessary and sufficient for the TLR2 inhibitory effect (PubMed:17486091). Required for induction of host (human) IL-1B maturation and release by activating the host NLRP3/ASC inflammasome; may also promote access of other tuberculosis proteins to the host cells cytoplasm (PubMed:20148899). Induces IL-8 (CXCL8) expression in host (human) lung epithelial cells (PubMed:23867456). Exogenously applied protein, or protein expressed in host (human and mouse), binds beta-2-microglobulin (B2M) and decreases its export to the cell surface, probably leading to defects in class I antigen presentation by the host cell (PubMed:25356553). Responsible for mitochondrial fragmention, redistribution around the cell nucleus and decreased mitochondrial mass; this effect is not seen until 48 hours post-infection (PubMed:26092385). Able to disrupt artificial planar bilayers in the absence of EsxB (CFP-10) (PubMed:14557547). Native protein binds artificial liposomes in the absence but not presence of EsxB and is able to rigidify and lyse them; the EsxA-EsxB complex dissociates at acidic pH, EsxB might serve as a chaperone to prevent membrane lysis (PubMed:17557817). Recombinant protein induces leakage of phosphocholine liposomes at acidic pH in the absence of ExsB, undergoes conformational change, becoming more alpha-helical at acidic pH (PubMed:23150662, PubMed:25645924). The study using recombinant protein did not find dissociation of EsxA-EsxB complex at acidic pH (PubMed:23150662). Involved in translocation of bacteria from the host (human) phagolysosome to the host cytoplasm (PubMed:17604718, PubMed:22319448). Translocation into host cytoplasm is visible 3 days post-infection using cultured human cells and precedes host cell death (PubMed:22319448). Recombinant protein induces apoptosis in host (human) differentiated cell lines, which is cell-line dependent; bacteria missing the ESX-1 locus do not induce apoptosis (PubMed:17298391). Host (human) cells treated with EsxA become permeable to extracellular dye (PubMed:17298391). EsxA and EsxA-EsxB are cytotoxic to pneumocytes (PubMed:19906174). ESX-1 secretion system-induced host (mouse) cell apoptosis, which is probably responsible for infection of new host cells, might be due to EsxA (PubMed:23848406). EsxA induces necrosis in aged neutrophils (PubMed:25321481). May help regulate assembly and function of the type VII secretion system (T7SS) (By similarity). EsxA disassembles pre-formed EccC-EsxB multimers, possibly by making EccC-EsxA-EsxB trimers instead of EccC-EsxB-EsxB-EccC tetramers (By similarity). {ECO:0000250|UniProtKB:D1A4H1, ECO:0000269|PubMed:11940590, ECO:0000269|PubMed:14557536, ECO:0000269|PubMed:14557547, ECO:0000269|PubMed:17298391, ECO:0000269|PubMed:17486091, ECO:0000269|PubMed:17557817, ECO:0000269|PubMed:17604718, ECO:0000269|PubMed:19265145, ECO:0000269|PubMed:19906174, ECO:0000269|PubMed:20148899, ECO:0000269|PubMed:21586573, ECO:0000269|PubMed:22319448, ECO:0000269|PubMed:23867456, ECO:0000269|PubMed:25321481, ECO:0000269|PubMed:25356553, ECO:0000269|PubMed:26092385, ECO:0000269|PubMed:26260636, ECO:0000269|PubMed:7729876, ECO:0000269|PubMed:7897219, ECO:0000305|PubMed:23848406}.; FUNCTION: May be critical in pro-bacteria versus pro-host interactions; ESX-1 mediates DNA mediated export (maybe via EsxA). The DNA interacts with host (human) cGAS, leading to cGAMP production and activation of the host STING-TBK-1-IRF-3 signaling pathway that leads to IFN-beta which is thought to be "pro-bacteria". Mycobacterial dsDNA also interacts with AIM2-NLRP3-ASC to activate an inflammasome, leading to the "pro-host" IL-1-beta (PubMed:26048138, PubMed:26048136). {ECO:0000269|PubMed:26048136, ECO:0000269|PubMed:26048138}.
- Family
-
WXG100 family, ESAT-6 subfamily
- GO
-
- InterPro
-
1WA8
-
- Name
-
6 kDa early secretory antigenic target (ESAT-6)
- Family
-
WXG100 family, ESAT-6 subfamily
- Protein
Sequence
-
MTEQQWNFAGIEAAASAIQGNVTSIHSLLDEGKQSLTKLAAAWGGSGSEAYQGVQQKWDATATELNNALQNLARTISEAGQAMASTEGNVTGMFA
-
Mass
-
9,904
Da
-
Length
-
95
Aa
Rv3875 doesn't seem to be a targeted by any
drug.
-
-
Tuberculosis
mtu05152
mtu05152
Human Diseases; Infectious disease: bacterial
-
WXG100 protein superfamily consists of three subfamilies and exhibits an alpha-helical C-terminal conserved residue pattern.
- PLoS One. 2014 Feb 26;9(2):e89313. doi: 10.1371/journal.pone.0089313. eCollection 2014.
-
Structure and function of the complex formed by the tuberculosis virulence factors CFP-10 and ESAT-6.
- EMBO J. 2005 Jul 20;24(14):2491-8. doi: 10.1038/sj.emboj.7600732. Epub 2005 Jun 23.
-
Stoichiometric protein complex formation and over-expression using the prokaryotic native operon structure.
- FEBS Lett. 2010 Feb 19;584(4):669-74. doi: 10.1016/j.febslet.2009.12.057. Epub 2010 Jan 18.
-
Mechanism of ESAT-6 membrane interaction and its roles in pathogenesis of Mycobacterium tuberculosis.
- Toxicon. 2016 Jun 15;116:29-34. doi: 10.1016/j.toxicon.2015.10.003. Epub 2015 Oct 9.
-
Characterization of differential pore-forming activities of ESAT-6 proteins from Mycobacterium tuberculosis and Mycobacterium smegmatis.
- FEBS Lett. 2016 Feb;590(4):509-19. doi: 10.1002/1873-3468.12072. Epub 2016 Feb 7.
-
Two distinct conformational states of Mycobacterium tuberculosis virulent factor early secreted antigenic target 6 kDa are behind the discrepancy around its biological functions.
- FEBS J. 2015 Nov;282(21):4114-29. doi: 10.1111/febs.13408. Epub 2015 Aug 28.
-
Infection of A549 human type II epithelial cells with Mycobacterium tuberculosis induces changes in mitochondrial morphology, distribution and mass that are dependent on the early secreted antigen, ESAT-6.
- Microbes Infect. 2015 Oct;17(10):689-97. doi: 10.1016/j.micinf.2015.06.003. Epub 2015 Jun 16.
-
The Cytosolic Sensor cGAS Detects Mycobacterium tuberculosis DNA to Induce Type I Interferons and Activate Autophagy.
- Cell Host Microbe. 2015 Jun 10;17(6):811-819. doi: 10.1016/j.chom.2015.05.004. Epub 2015 Jun 2.
-
Mycobacterium tuberculosis Differentially Activates cGAS- and Inflammasome-Dependent Intracellular Immune Responses through ESX-1.
- Cell Host Microbe. 2015 Jun 10;17(6):799-810. doi: 10.1016/j.chom.2015.05.003. Epub 2015 Jun 2.
-
Characterization of Mycobacterium tuberculosis EsxA membrane insertion: roles of N- and C-terminal flexible arms and central helix-turn-helix motif.
- J Biol Chem. 2015 Mar 13;290(11):7314-22. doi: 10.1074/jbc.M114.622076. Epub 2015 Feb 2.
-
The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (beta2M) affecting antigen presentation function of macrophage.
- PLoS Pathog. 2014 Oct 30;10(10):e1004446. doi: 10.1371/journal.ppat.1004446. eCollection 2014 Oct.
-
Mycobacterium tuberculosis ESAT-6 is a leukocidin causing Ca2+ influx, necrosis and neutrophil extracellular trap formation.
- Cell Death Dis. 2014 Oct 16;5:e1474. doi: 10.1038/cddis.2014.394.
-
Anticytolytic screen identifies inhibitors of mycobacterial virulence protein secretion.
- Cell Host Microbe. 2014 Oct 8;16(4):538-48. doi: 10.1016/j.chom.2014.09.008.
-
Early secreted antigenic target of 6 kDa (ESAT-6) protein of Mycobacterium tuberculosis induces interleukin-8 (IL-8) expression in lung epithelial cells via protein kinase signaling and reactive oxygen species.
- J Biol Chem. 2013 Aug 30;288(35):25500-11. doi: 10.1074/jbc.M112.448217. Epub 2013 Jul 18.
-
ESX-1-induced apoptosis is involved in cell-to-cell spread of Mycobacterium tuberculosis.
- Cell Microbiol. 2013 Dec;15(12):1994-2005. doi: 10.1111/cmi.12169. Epub 2013 Aug 2.
-
Mycobacterium tuberculosis ESAT-6 exhibits a unique membrane-interacting activity that is not found in its ortholog from non-pathogenic Mycobacterium smegmatis.
- J Biol Chem. 2012 Dec 28;287(53):44184-91. doi: 10.1074/jbc.M112.420869. Epub 2012 Nov 13.
-
ESX-1-mediated translocation to the cytosol controls virulence of mycobacteria.
- Cell Microbiol. 2012 Aug;14(8):1287-98. doi: 10.1111/j.1462-5822.2012.01799.x. Epub 2012 May 8.
-
Phagosomal rupture by Mycobacterium tuberculosis results in toxicity and host cell death.
- PLoS Pathog. 2012 Feb;8(2):e1002507. doi: 10.1371/journal.ppat.1002507. Epub 2012 Feb 2.
-
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
-
The Mycobacterium tuberculosis early secreted antigenic target of 6 kDa inhibits T cell interferon-gamma production through the p38 mitogen-activated protein kinase pathway.
- J Biol Chem. 2011 Jul 8;286(27):24508-18. doi: 10.1074/jbc.M111.234062. Epub 2011 May 17.
-
Mycobacterium tuberculosis protein ESAT-6 is a potent activator of the NLRP3/ASC inflammasome.
- Cell Microbiol. 2010 Aug;12(8):1046-63. doi: 10.1111/j.1462-5822.2010.01450.x. Epub 2010 Feb 9.
-
Potential role for ESAT6 in dissemination of M. tuberculosis via human lung epithelial cells.
- Mol Microbiol. 2010 Jan;75(1):92-106. doi: 10.1111/j.1365-2958.2009.06959.x. Epub 2009 Nov 10.
-
Conservation of structure and protein-protein interactions mediated by the secreted mycobacterial proteins EsxA, EsxB, and EspA.
- J Bacteriol. 2010 Jan;192(1):326-35. doi: 10.1128/JB.01032-09.
-
Non-acylated Mycobacterium bovis glycoprotein MPB83 binds to TLR1/2 and stimulates production of matrix metalloproteinase 9.
- Biochem Biophys Res Commun. 2010 Sep 24;400(3):403-8. doi: 10.1016/j.bbrc.2010.08.085. Epub 2010 Aug 26.
-
Systematic genetic nomenclature for type VII secretion systems.
- PLoS Pathog. 2009 Oct;5(10):e1000507. doi: 10.1371/journal.ppat.1000507. Epub 2009 Oct 30.
-
ESX-1 secreted virulence factors are recognized by multiple cytosolic AAA ATPases in pathogenic mycobacteria.
- Mol Microbiol. 2009 Sep;73(5):950-62. doi: 10.1111/j.1365-2958.2009.06821.x. Epub 2009 Aug 4.
-
ESAT-6 inhibits production of IFN-gamma by Mycobacterium tuberculosis-responsive human T cells.
- J Immunol. 2009 Mar 15;182(6):3668-77. doi: 10.4049/jimmunol.0803579.
-
ESAT-6 from Mycobacterium tuberculosis dissociates from its putative chaperone CFP-10 under acidic conditions and exhibits membrane-lysing activity.
- J Bacteriol. 2007 Aug;189(16):6028-34. doi: 10.1128/JB.00469-07. Epub 2007 Jun 8.
-
M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells.
- Cell. 2007 Jun 29;129(7):1287-98. doi: 10.1016/j.cell.2007.05.059.
-
Direct extracellular interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2 inhibits TLR signaling in macrophages.
- Nat Immunol. 2007 Jun;8(6):610-8. doi: 10.1038/ni1468. Epub 2007 May 7.
-
The ESAT6 protein of Mycobacterium tuberculosis induces apoptosis of macrophages by activating caspase expression.
- Cell Microbiol. 2007 Jun;9(6):1547-55. doi: 10.1111/j.1462-5822.2007.00892.x. Epub 2007 Feb 9.
-
C-terminal signal sequence promotes virulence factor secretion in Mycobacterium tuberculosis.
- Science. 2006 Sep 15;313(5793):1632-6. doi: 10.1126/science.1131167.
-
Dissection of ESAT-6 system 1 of Mycobacterium tuberculosis and impact on immunogenicity and virulence.
- Infect Immun. 2006 Jan;74(1):88-98. doi: 10.1128/IAI.74.1.88-98.2006.
-
Functional analysis of early secreted antigenic target-6, the dominant T-cell antigen of Mycobacterium tuberculosis, reveals key residues involved in secretion, complex formation, virulence, and immunogenicity.
- J Biol Chem. 2005 Oct 7;280(40):33953-9. doi: 10.1074/jbc.M503515200. Epub 2005 Jul 27.
-
Mutually dependent secretion of proteins required for mycobacterial virulence.
- Proc Natl Acad Sci U S A. 2005 Jul 26;102(30):10676-81. doi: 10.1073/pnas.0504922102. Epub 2005 Jul 19.
-
Individual RD1-region genes are required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis.
- Mol Microbiol. 2004 Jan;51(2):359-70. doi: 10.1046/j.1365-2958.2003.03844.x.
-
Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system.
- Proc Natl Acad Sci U S A. 2003 Oct 28;100(22):13001-6. doi: 10.1073/pnas.2235593100. Epub 2003 Oct 13.
-
The primary mechanism of attenuation of bacillus Calmette-Guerin is a loss of secreted lytic function required for invasion of lung interstitial tissue.
- Proc Natl Acad Sci U S A. 2003 Oct 14;100(21):12420-5. doi: 10.1073/pnas.1635213100. Epub 2003 Oct 13.
-
Conclusive evidence that the major T-cell antigens of the Mycobacterium tuberculosis complex ESAT-6 and CFP-10 form a tight, 1:1 complex and characterization of the structural properties of ESAT-6, CFP-10, and the ESAT-6*CFP-10 complex. Implications for pathogenesis and virulence.
- J Biol Chem. 2002 Jun 14;277(24):21598-603. doi: 10.1074/jbc.M201625200. Epub 2002 Apr 8.
-
CFP10 discriminates between nonacetylated and acetylated ESAT-6 of Mycobacterium tuberculosis by differential interaction.
- Proteomics. 2004 Oct;4(10):2954-60. doi: 10.1002/pmic.200400906.
-
A Mycobacterium tuberculosis operon encoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10).
- Microbiology. 1998 Nov;144 ( Pt 11):3195-203. doi: 10.1099/00221287-144-11-3195.
-
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
-
Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis.
- Infect Immun. 1995 May;63(5):1710-7.
-
Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice.
- J Immunol. 1995 Apr 1;154(7):3359-72.